Previous Contig 005919:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007H24Sequence307005919 (5)gb:AC005309_15324725e-10Arabidopsis thaliana chromosome 2 clone F17A22 map CIC06C03, complete sequence.>757013904 (4)gb:AC005309_15324727e-43Arabidopsis thaliana chromosome 2 clone F17A22 map CIC06C03, complete sequence.>
JMSF007O18Sequence304005919 (5)gb:AC005309_15324725e-10Arabidopsis thaliana chromosome 2 clone F17A22 map CIC06C03, complete sequence.>752013904 (4)gb:AC005309_15324722e-42Arabidopsis thaliana chromosome 2 clone F17A22 map CIC06C03, complete sequence.>
JMSF008H24Sequence237005919 (5)gb:AC005309_15324723e-06Arabidopsis thaliana chromosome 2 clone F17A22 map CIC06C03, complete sequence.>752013904 (4)gb:AC005309_15324722e-42Arabidopsis thaliana chromosome 2 clone F17A22 map CIC06C03, complete sequence.>
JMSF020K22Sequence702005919 (5)pir|F84921|F849212e-30hypothetical protein At2g47960 [imported] - Arabidopsis thaliana772022936gb:AC005309_15324724e-44Arabidopsis thaliana chromosome 2 clone F17A22 map CIC06C03, complete sequence.>
JMSF050N03Sequence696005919 (5)pir|F84921|F849212e-30hypothetical protein At2g47960 [imported] - Arabidopsis thaliana752013904 (4)gb:AC005309_15324723e-29Arabidopsis thaliana chromosome 2 clone F17A22 map CIC06C03, complete sequence.>

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF050N03+ AGCTGATCCAAATGCATTCATAGAGTGCCTAATATGTGCAACAG
JMSF020K22+ CTGATCCAAATGCATTCATAGAGTGCCTAATATGTGCAACAG
                      ____________________________________________________________
consensus AGCTGATCCAAATGCATTCATAGAGTGCCTAATATGTGCAACAG
 
. : . : . : . : . : . :
JMSF050N03+ TTCATTGCAAAGAACAAATCAACCAATCATTCGTCAATCCACCTTGATTACAATATCCCT
JMSF020K22+ TTCATTGCAAAGAACAAATCAACCAATCATTCGTCAATCCACCTTGATTACAATATCCCT
                      ____________________________________________________________
consensus TTCATTGCAAAGAACAAATCAACCAATCATTCGTCAATCCACCTTGATTACAATATCCCT
 
. : . : . : . : . : . :
JMSF050N03+ GACTTCGAAACTCGAACTGTTGTTTATACTTATATAACTGCAGAACGTCTCCCCCAGATA
JMSF020K22+ GACTTCGAAACTCGAACTGTTGTTTATACTTATATAACTGCAGAACGTCTCCCCCAGATA
                      ____________________________________________________________
consensus GACTTCGAAACTCGAACTGTTGTTTATACTTATATAACTGCAGAACGTCTCCCCCAGATA
 
. : . : . : . : . : . :
JMSF050N03+ TATTGCCCTGCAAGGACATCTCAATTTCTCATTAATTAAAATACAAAAAACACTACTAAA
JMSF020K22+ TATTGCCCTGCAAGGACATCTCAATTTCTCATTAATTAAAATACAAAAAACACTACTAAA
                      ____________________________________________________________
consensus TATTGCCCTGCAAGGACATCTCAATTTCTCATTAATTAAAATACAAAAAACACTACTAAA
 
. : . : . : . : . : . :
JMSF050N03+ TCAGGATAGTGTCAGGCAATGTATATGGTATAGAGAGAGCGAGGATGGAAAACTAACCCG
JMSF020K22+ TCAGGATAGTGTCAGGCAATGTATATGGTATAGAGAGAGCGAGGATGGAAAACTAACCCG
                      ____________________________________________________________
consensus TCAGGATAGTGTCAGGCAATGTATATGGTATAGAGAGAGCGAGGATGGAAAACTAACCCG
 
. : . : . : . : . : . :
JMSF050N03+ AAAGACTGAGGAAGGACGAGGAGGCCAGGTAGGCCGACGGATTCGGAGGACTGTTCGAGG
JMSF020K22+ AAAGACTGAGGAAGGACGAGGAGGCCAGGTAGGCCGACGGATTCGGAGGACTGTTCGAGG
                      ____________________________________________________________
consensus AAAGACTGAGGAAGGACGAGGAGGCCAGGTAGGCCGACGGATTCGGAGGACTGTTCGAGG
 
. : . : . : . : . : . :
JMSF050N03+ AGGAATCTGGAGCGGTAGGAGAGATCGGAGGGGTCAACGACGTTGGGGCCGGCGTTGACA
JMSF007O18+ ACA
JMSF007H24+ TTGACA
JMSF020K22+ AGGAATCTGGAGCGGTAGGAGAGATCGGAGGGGTCAACGACGTTGGGGCCGGCGTTGACA
                      ____________________________________________________________
consensus AGGAATCTGGAGCGGTAGGAGAGATCGGAGGGGTCAACGACGTTGGGGCCGGCGTTGACA
 
. : . : . : . : . : . :
JMSF050N03+ GAGTCGCCGGAGAGGAGACGGGGGAGGTGATCGGCGGCGAGGGAGTCGTCGAACAAGTCC
JMSF007O18+ GAGTCGCCGGAGAGGAGACGGGGGAGGTGATCGGCGGCGAGGGAGTCGTCGAACAAGTCC
JMSF007H24+ GAGTCGCCGGAGAGGAGACGGGGGAGGTGATCGGCGGCGAGGGAGTCGTCGAACAAGTCC
JMSF020K22+ GAGTCGCCGGAGAGGAGACGGGGGAGGTGATCGGCGGCGAGGGAGTCGTCGAACAAGTCC
                      ____________________________________________________________
consensus GAGTCGCCGGAGAGGAGACGGGGGAGGTGATCGGCGGCGAGGGAGTCGTCGAACAAGTCC
 
. : . : . : . : . : . :
JMSF050N03+ TCGCCGAAAAGCAGATCGCAGGCGTTGAATCGAAGCGGGGTTTCGACGTGAAGTGATGGC
JMSF007O18+ TCGCCGAAAAGCAGATCGCAGGCGTTGAATCGAAGCGGGGTTTCGACGTGAAGTGATGGC
JMSF008H24+ CGAAAAGCAGATCGCAGGCGTTGAATCGAAGCGGGGTTTCGACGTGAAGTGATGGC
JMSF007H24+ TCGCCGAAAAGCAGATCGCAGGCGTTGAATCGAAGCGGGGTTTCGACGTGAAGTGATGGC
JMSF020K22+ TCGCCGAAAAGCAGATCGCAGGCGTTGAATCGAAGCGGGGTTTCGACGTGAAGTGATGGC
                      ____________________________________________________________
consensus TCGCCGAAAAGCAGATCGCAGGCGTTGAATCGAAGCGGGGTTTCGACGTGAAGTGATGGC
 
. : . : . : . : . : . :
JMSF050N03+ CTGCAGAGCCTCATCACCCGGAAGGCAAGCGAGTGTGGAGTTTGTGTAGCGCTGCTGCTA
JMSF007O18+ CTGCAGAGCCTCATCACCCGGAAGGCAAGCGAGTGTGGAGTTTGTGTAGCGCTGCTGCTA
JMSF008H24+ NTGCAGAGCCTCATCACCCGGAAGGCAAGCGAGTGTGGAGTTTGTGTAGCGCTGCTGCTA
JMSF007H24+ CTGCAGAGCCTCATCACCCGGAAGGCAAGCGAGTGTGGAGTTTGTGTAGCGCTGCTGCTA
JMSF020K22+ CTGCAGAGCCTCATCACCCGGAAGGCAAGCGAGTGTGGAGTTTGTGTAGCGCTGCTGCTA
                      ____________________________________________________________
consensus CTGCAGAGCCTCATCACCCGGAAGGCAAGCGAGTGTGGAGTTTGTGTAGCGCTGCTGCTA
 
. : . : . : . : . : . :
JMSF050N03+ CTCATCTTCTCCAAACTCTCTCTCTGACTTCACACTCTCCCTTCACCTCAGCTCTGATTT
JMSF007O18+ CTCATCTTCTCCAAACTCTCTCTCTGACTTCACACTCTCCCTTCACCTCAGCTCTGATTT
JMSF008H24+ CTCATCTTCTCCAAACTCTCTCTCTGACTTCACACTCTCCCTTCACCTCAGCTCTGATTT
JMSF007H24+ CTCATCTTCTCCAAACTCTCTCTCTGACTTCACACTCTCCCTTCACCTCAGCTCTGATTT
JMSF020K22+ CTCATCTTCTCCAAACTCTCTCTCTGACTTCACACTCTCCCTTCACCTCAGCTCTGATTT
                      ____________________________________________________________
consensus CTCATCTTCTCCAAACTCTCTCTCTGACTTCACACTCTCCCTTCACCTCAGCTCTGATTT
 
. : . : . : . : . : . :
JMSF050N03+ GGAAGCTTTTTGCCTTCGAAATGGTCGAAATGGTAATCCAACTTGCAGACC
JMSF007O18+ GGAAGCTTTTTGCCTTCGAAATGGTCGAAATGGTAATCCAACTTGCAGA
JMSF008H24+ GGAAGCTTTTTGCCTTCGAAATGGTCGAAATGGTAATCCAACTTGCAGA
JMSF007H24+ GGAAGCTTTTTGCCTTCGAAATGGTCGAAATGGTAATCCAACTTGCAGA
JMSF020K22+ GGAAGCTTTTTGCCTTCGAAATGGTCGAAATGGTAATCCAACTTGCAGACCAGTACGGTC
                      ____________________________________________________________
consensus GGAAGCTTTTTGCCTTCGAAATGGTCGAAATGGTAATCCAACTTGCAGACCAGTACGGTC