Previous Contig 005914:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003I23Sequence274005914 (3)734022085
JMSF020K04Sequence679005914 (3)341012664 (4)
JMSF020L09Sequence675005914 (3)368012664 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF020L09+ AAAAAAAGTGTTATT
JMSF020K04+ AAAAAAAAAAAGTGTTATT
                      ____________________________________________________________
consensus AAAAAAAAAAAGTGTTATT
 
. : . : . : . : . : . :
JMSF020L09+ TTTATGCAACCAAGAAAAACCAACACCTAAGAGCTTATATATAAGCTACAACTACCACCA
JMSF020K04+ TTTATGCAACCAAGAAAAACCAACACCTAAGAGCTTATATATAAGCTACAACTACCACCA
                      ____________________________________________________________
consensus TTTATGCAACCAAGAAAAACCAACACCTAAGAGCTTATATATAAGCTACAACTACCACCA
 
. : . : . : . : . : . :
JMSF020L09+ CTTTGCCAGTTTTCCTATTCCCACAAACTAATTACACACAGCAGACATGAGGAAAATACT
JMSF020K04+ CTTTGCCAGTTTTCCTATTCCCACAAACTAATTACACACAGCAGACATGAGGAAAATACT
                      ____________________________________________________________
consensus CTTTGCCAGTTTTCCTATTCCCACAAACTAATTACACACAGCAGACATGAGGAAAATACT
 
. : . : . : . : . : . :
JMSF020L09+ GGCTTCTACAATTATAGGGAGCAAAAGGAAGAAGCCACTTCAGAGCCAAGGTACCATACC
JMSF020K04+ GGCTTCTACAATTATAGGGAGCAAAAGGAAGAAGCCACTTCAGAGCCAAGGTACCATACC
                      ____________________________________________________________
consensus GGCTTCTACAATTATAGGGAGCAAAAGGAAGAAGCCACTTCAGAGCCAAGGTACCATACC
 
. : . : . : . : . : . :
JMSF020L09+ CAAATTAAATACTGTAATTGAAGGTTTACCTGTACAGTATGTATACCTGTTTTAAAGCTT
JMSF020K04+ CAAATTAAATACTGTAATTGAAGGTTTACCTGTACAGTATGTATACCTGTTTTAAAGCTT
                      ____________________________________________________________
consensus CAAATTAAATACTGTAATTGAAGGTTTACCTGTACAGTATGTATACCTGTTTTAAAGCTT
 
. : . : . : . : . : . :
JMSF020L09+ TCATGCATGCTTCACTTGCAAACTTGATTACATTTGTATACATATGAATAATAGATCCCT
JMSF020K04+ TCATGCATGCTTCACTTGCAAACTTGATTACATTTGTATACATATGAATAATAGATCCCT
                      ____________________________________________________________
consensus TCATGCATGCTTCACTTGCAAACTTGATTACATTTGTATACATATGAATAATAGATCCCT
 
. : . : . : . : . : . :
JMSF020L09+ TATACTTTATAGTTGATGAGAACGGTGAAGAATCCACATCTCTTAGTAGCAGTTTAGACG
JMSF020K04+ TATACTTTATAGTTGATGAGAACGGTGAAGAATCCACATCTCTTAGTAGCAGTTTAGACG
                      ____________________________________________________________
consensus TATACTTTATAGTTGATGAGAACGGTGAAGAATCCACATCTCTTAGTAGCAGTTTAGACG
 
. : . : . : . : . : . :
JMSF020L09+ AAGATCTATGGGTAAAACACCAGATCTGTAACTAAAAACGAAGATCGAAGGTCTAAAACT
JMSF003I23+ CCAGATCTGTAACTAAAAACGAAGATCGAAGGTCTAAAACT
JMSF020K04+ AAGATCTATGGGTAAAACACCAGATCTGTAACTAAAAACGAAGATCGAAGGTCTAAAACT
                      ____________________________________________________________
consensus AAGATCTATGGGTAAAACACCAGATCTGTAACTAAAAACGAAGATCGAAGGTCTAAAACT
 
. : . : . : . : . : . :
JMSF020L09+ ATGCCCATCTGCCGATTGCAACTAGGTTTTTGTAATCAGCAAAATCTTATGATCATCGCT
JMSF003I23+ ATGCCCATCTGCCGATTGCAACTAGGTTTTTGTAATCAGCAAAATCTTATGATCATCGCT
JMSF020K04+ ATGCCCATCTGCCGATTGCAACTAGGTTTTTGTAATCAGCAAAATCTTATGATCATCGCT
                      ____________________________________________________________
consensus ATGCCCATCTGCCGATTGCAACTAGGTTTTTGTAATCAGCAAAATCTTATGATCATCGCT
 
. : . : . : . : . : . :
JMSF020L09+ GGGTAATAAATAACAACAAATATATGTAGAAATCAATTTCGTGGATTTAAGTATTTAGGA
JMSF003I23+ GGGTAATAAATAACAACAAATATATGTAGAAATCAATTTCGTGGATTTAAGTATTTAGGA
JMSF020K04+ GGGTAATAAATAACAACAAATATATGTAGAAATCAATTTCGTGGATTTAAGTATTTAGGA
                      ____________________________________________________________
consensus GGGTAATAAATAACAACAAATATATGTAGAAATCAATTTCGTGGATTTAAGTATTTAGGA
 
. : . : . : . : . : . :
JMSF020L09+ TGAAGGTTGTAGACAAGGAAATCGGATTGGAAAGCATAGATTATACGAGCTAAGACGAGA
JMSF003I23+ TGAAGGTTGTAGACAAGGAAATCGGATTGGAAAGCATAGATTATACGAGCTAAGACGAGA
JMSF020K04+ TGAAGGTTGTAGACAAGGAAATCGGATTGGAAAGCATAGATTATACGAGCTAAGACGAGA
                      ____________________________________________________________
consensus TGAAGGTTGTAGACAAGGAAATCGGATTGGAAAGCATAGATTATACGAGCTAAGACGAGA
 
. : . : . : . : . : . :
JMSF020L09+ AGAGAGAATAAACAGACACAGAGAGATCCATAGAGAGACAATCGGAAATGGC
JMSF003I23+ AGAGAGAATACACAGACACAGAGAGATCCATAGAGAGACAATCGGAAATGGC
JMSF020K04+ AGAGAGAATAAACAGACACAGAGAGATCCATAGAGAGACAATCGGAAATGGCGGTCAACC
                      ____________________________________________________________
consensus AGAGAGAATAAACAGACACAGAGAGATCCATAGAGAGACAATCGGAAATGGCGGTCAACC