Previous Contig 005908:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027D13Sequence518005908 (2)gb:AF277377_17827668e-18Arabidopsis thaliana 5' repair endonuclease (UVH1) gene, complete cds.666009491 (2)gb:AB010072_15109316e-82Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MEE6.>gb:AY140076_15825
JMSF020J11Sequence675005908 (2)gb:AF277377_17827664e-41Arabidopsis thaliana 5' repair endonuclease (UVH1) gene, complete cds.807009491 (2)gb:AB010072_1510931e-109Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MEE6.>gb:AY140076_15825

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF020J11+ CGAGNCCAAAGATGA
                      ____________________________________________________________
consensus CGAGNCCAAAGATGA
 
. : . : . : . : . : . :
JMSF020J11+ AGCTTTCTGAGCCAAAGGCATTTTAAGGTTCGTTCAGCCTTGGCGAAGCCGGAGACCATG
                      ____________________________________________________________
consensus AGCTTTCTGAGCCAAAGGCATTTTAAGGTTCGTTCAGCCTTGGCGAAGCCGGAGACCATG
 
. : . : . : . : . : . :
JMSF020J11+ GCATGAGGGCGGTCCGAGAAAGCCCTAACATAGAGTGACCGGTTAGTCGAACGGATAATC
                      ____________________________________________________________
consensus GCATGAGGGCGGTCCGAGAAAGCCCTAACATAGAGTGACCGGTTAGTCGAACGGATAATC
 
. : . : . : . : . : . :
JMFF027D13+ GAGGTATCAGAGAGGGAGTGAGCGTTGAGGAGGAGGATT
JMSF020J11+ CTAACGATAAAAGCCTCGGTGGAGGTATCAGAGAGGGAGTGAGCGTTGAGGAGGAGGATT
                      ____________________________________________________________
consensus CTAACGATAAAAGCCTCGGTGGAGGTATCAGAGAGGGAGTGAGCGTTGAGGAGGAGGATT
 
. : . : . : . : . : . :
JMFF027D13+ CCGGCTACGGCGGTAGTAGGCAGCCGGTGAGTGAGGAGGTCAACGATGAGAATACGCGCA
JMSF020J11+ CCGGCTACGGCGGTAGTAGGCAGCCGGTGAGTGAGGAGGTCAACGATGAGAATACGCGCA
                      ____________________________________________________________
consensus CCGGCTACGGCGGTAGTAGGCAGCCGGTGAGTGAGGAGGTCAACGATGAGAATACGCGCA
 
. : . : . : . : . : . :
JMFF027D13+ GTGATGAAGAACACTCCGCCGGAAGTATAGAGCGACAGGCGCTGGTGCGCGGGGAGGTCG
JMSF020J11+ GTGATGAAGAACACTCCGCCGGAAGTATAGAGCGACAGGCGCTGGTGCGCGGGGAGGTCG
                      ____________________________________________________________
consensus GTGATGAAGAACACTCCGCCGGAAGTATAGAGCGACAGGCGCTGGTGCGCGGGGAGGTCG
 
. : . : . : . : . : . :
JMFF027D13+ GAGGTAATCTCCGAGGGCAAATTGGGAACTTCACTTGTGCTGGGAACGGAGCTCTCGTAT
JMSF020J11+ GAGGTAATCTCCGAGGGCAAATTGGGAACTTCACTTGTGCTGGGAACGGAGCTCTCGTAT
                      ____________________________________________________________
consensus GAGGTAATCTCCGAGGGCAAATTGGGAACTTCACTTGTGCTGGGAACGGAGCTCTCGTAT
 
. : . : . : . : . : . :
JMFF027D13+ TGGAGCGCGATCTCGAGATTTCGAACAATGGCGTGTCTCTGAGAAGGAGAGGCGGAGAGG
JMSF020J11+ TGGAGCGCGATCTCGAGATTTCGAACAATGGCGTGTCTCTGAGAAGGAGAGGCGGAGAGG
                      ____________________________________________________________
consensus TGGAGCGCGATCTCGAGATTTCGAACAATGGCGTGTCTCTGAGAAGGAGAGGCGGAGAGG
 
. : . : . : . : . : . :
JMFF027D13+ ATGAGGAGGGAGCCCTGGGAAGAGTGATGGAGGAGGAGAAGAGAGGAGATGAGCTTGTGG
JMSF020J11+ ATGAGGAGGGAGCCCTGGGAAGAGTGATGGAGGAGGAGAAGAGAGGAGATGAGCTTGTGG
                      ____________________________________________________________
consensus ATGAGGAGGGAGCCCTGGGAAGAGTGATGGAGGAGGAGAAGAGAGGAGATGAGCTTGTGG
 
. : . : . : . : . : . :
JMFF027D13+ AGGCCTAGGCCGGCGGAGAGGACGACTAAACCGCCGTTTTGGTCTTCGAGGAGTTCCGCT
JMSF020J11+ AGGCCTAGGCCGGCGGAGAGGACGACTAAACCGCCGTTTTGGTCTTCGAGGAGTTCCGCT
                      ____________________________________________________________
consensus AGGCCTAGGCCGGCGGAGAGGACGACTAAACCGCCGTTTTGGTCTTCGAGGAGTTCCGCT
 
. : . : . : . : . : . :
JMFF027D13+ ACTATGTGCTCGTGAAATTGAACCATTTTCGTTTAAGTCCCAAGCAGAACCACGGTGGCT
JMSF020J11+ ACTATGTGCTCGTGAAATTGAACCATTTTCGTTTAAGTCCCAAGCAGAACCACGGTGGCT
                      ____________________________________________________________
consensus ACTATGTGCTCGTGAAATTGAACCATTTTCGTTTAAGTCCCAAGCAGAACCACGGTGGCT
 
. : . : . : . : . : . :
JMFF027D13+ CTACGCCGCAGTCACGGGCTCTCGCGGCGGCGATGGAGAGAGAATTTTAGCGGCGCC
JMSF020J11+ CTACGCCGCAGTCACGGGCTCTCGCGGCGGCGATGGAGAGAGAATTTTAGCGGCGCCGCC
                      ____________________________________________________________
consensus CTACGCCGCAGTCACGGGCTCTCGCGGCGGCGATGGAGAGAGAATTTTAGCGGCGCCGCC