Previous Contig 005904:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN040H04Sequence624005904 (7)gb:AB011476_15114032e-38Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDA7.>gb:BT000873_16351
JMSF020I08Sequence653005904 (7)gb:AB011476_15114031e-41Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDA7.>gb:BT000873_16351728005904 (7)gb:AP005052_18473311e-57Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P065
JMSF040O02Sequence656005904 (7)gb:AB011476_15114035e-43Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDA7.>gb:BT000873_16351871005904 (7)gb:AP005052_18473312e-68Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P065
JMSF044P12Sequence691005904 (7)gb:AB011476_15114039e-58Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDA7.>gb:BT000873_16351600005904 (7)gb:AP005052_18473312e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P065

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF020I08- TGGTG
rJMSF044P12- AAACCCACAACCAGTGTTTGGTG
rJMSF040O02- AAACCCACAACCAGTGTTTGGTG
                      ____________________________________________________________
consensus AAACCCACAACCAGTGTTTGGTG
 
. : . : . : . : . : . :
rJMSF020I08- GATTGTTTTCAGAATCCATATACAATGCATAATAACCTTACTACTAATAGGAATCCCATC
rJMSF044P12- GATTGTTTTCAGAATCCATATACAATGCATAATAACCTTACTACTAATAGGAATCCCATC
rJMSF040O02- GATTGTTTTCAGAATCCATATACAATGCATAATAACCTTACTACTAATAGGAATCCCATC
                      ____________________________________________________________
consensus GATTGTTTTCAGAATCCATATACAATGCATAATAACCTTACTACTAATAGGAATCCCATC
 
. : . : . : . : . : . :
rJMSF020I08- ATCAAAACTAGTTGCATACTTAACAGATGCATTGGAAAGACACTAGCCTAAACAAACTAT
rJMSF044P12- ATCAAAACTAGTTGCATACTTAACAGATGCATTGGAAAGACACTAGCCTAAACAAACTAT
rJMSF040O02- ATCAAAACTAGTTGCATACTTAACAGATGCATTGGAAAGACACTAGCCTAAACAAACTAT
                      ____________________________________________________________
consensus ATCAAAACTAGTTGCATACTTAACAGATGCATTGGAAAGACACTAGCCTAAACAAACTAT
 
. : . : . : . : . : . :
rJMSF020I08- CTAGAGCACATCAACCAACCCTGCAACACACTGTCATACTATGTTCTTCTTGCTAAATCG
rJMSF044P12- CTAGAGCACATCAACCAACCCTGCAACACACTGTCATACTATGTTCTTCTTGCTAAATCG
rJMSF040O02- CTAGAGCACATCAACCAACCCTGCAACACACTGTCATACTATGTTCTTCTTGCTAAATCG
                      ____________________________________________________________
consensus CTAGAGCACATCAACCAACCCTGCAACACACTGTCATACTATGTTCTTCTTGCTAAATCG
 
. : . : . : . : . : . :
rJMSF020I08- ATCCCCAAGCAAACATAAACACACCGCATATCACATGCAAACCGGCATGTAACAGTGCCA
rJMSF044P12- ATCCCCAAGCAAACATAAACACACCGCATATCACATGCAAACCGGCATGTAACAGTGCCA
rJMSF040O02- ATCCCCAAGCAAACATAAACACACCGCATATCACATGCAAACCGGCATGTAACAGTGCCA
                      ____________________________________________________________
consensus ATCCCCAAGCAAACATAAACACACCGCATATCACATGCAAACCGGCATGTAACAGTGCCA
 
. : . : . : . : . : . :
rJMSF020I08- GTGCCCCGACGGCATTGGATGTGTAGCCTGGACAGCAACTACTAGTTGCATCCGAGATTC
rJMSF044P12- GTGCCCCGACGGCATTGGATGTGTAGCCTGGACAGCAACTACTAGTTGCATCCGAGATTC
rJMSF040O02- GTGCCCCGACGGCATTGGATGTGTAGCCTGGACAGCAACTACTAGTTGCATCCGAGATTC
                      ____________________________________________________________
consensus GTGCCCCGACGGCATTGGATGTGTAGCCTGGACAGCAACTACTAGTTGCATCCGAGATTC
 
. : . : . : . : . : . :
rJMSF020I08- GGCTCAGTAGTAGCTCAAATGGAAGCCCACTAAGAAAACTGATTACCCCCTTGTCTTGGC
rJMSF044P12- GGCTCAGTAGTAGCTCAAATGGAAGCCCACTAAGAAAACTGATTACCCCCTTGTCTTGGC
rJMSF040O02- GGCTCAGTAGTAGCTCAAATGGAAGCCCACTAAGAAAACTGATTACCCCCTTGTCTTGGC
                      ____________________________________________________________
consensus GGCTCAGTAGTAGCTCAAATGGAAGCCCACTAAGAAAACTGATTACCCCCTTGTCTTGGC
 
. : . : . : . : . : . :
rJMSF020I08- CCTCTTCATCCCAAGGCTGTTGTTGAAGGGGGAAACAGAACCAGACATTTGAGAACCTTC
rJMSF044P12- CCTCTTCATCCCAAGGCTGTTGTTGAAGGGGGAAACAGAACCAGACATTTGAGAACCTTC
rJMSF040O02- CCTCTTCATCCCAAGGCTGTTGTTGAAGGGGGAAACAGAACCAGACATTTGAGAACCTTC
                      ____________________________________________________________
consensus CCTCTTCATCCCAAGGCTGTTGTTGAAGGGGGAAACAGAACCAGACATTTGAGAACCTTC
 
. : . : . : . : . : . :
rJMSF020I08- TTCTCTCAGTGTACCATTCAGCATTGCCAATTCCCGTAGCTGGTGCTTTTTATAAAAATC
rJMSF044P12- TTCTCTCAGTGTACCATTCAGCATTGCCAATTCCCGTAGCTGGTGCTTTTTATAAAAATC
rJMSF040O02- TTCTCTCAGTGTACCATTCAGCATTGCCAATTCCCGTAGCTGGTGCTTTTTATAAAAATC
                      ____________________________________________________________
consensus TTCTCTCAGTGTACCATTCAGCATTGCCAATTCCCGTAGCTGGTGCTTTTTATAAAAATC
 
. : . : . : . : . : . :
rJMSF020I08- TTGAGATTCATCCACAGGCTTGAGTAGATCTTCAAGTATCTCACGTGCTTGCATTAACCG
rJMSF044P12- TTGAGATTCATCC
rJMSF040O02- TTGAGATTCATCCACAGGCTTGAGTAGATCTTCAAGTATCTCACGTGCTTGCATTAACCG
                      ____________________________________________________________
consensus TTGAGATTCATCCACAGGCTTGAGTAGATCTTCAAGTATCTCACGTGCTTGCATTAACCG
 
. : . : . : . : . : . :
rJMSF020I08- AGCATCAATTATCTCCACTGGCAGTTCAGCCTCCACAACTACATGCAAGGGTTCATTCAA
rJMSF040O02- AGCATCAATTATCTCCACTGGCAGTTCAGCCTCCACAACTACATGCAAGGGTTCATTCAA
                      ____________________________________________________________
consensus AGCATCAATTATCTCCACTGGCAGTTCAGCCTCCACAACTACATGCAAGGGTTCATTCAA
 
. : . : . : . : . : . :
rJMSF020I08- GTGTTCATACCCAGGTTTACCTCTCATCACCTCTTCCTTTGTAGGGTCCTTGATGCTTCC
rJMSF040O02- GTGTTCATACCCAGGTTTACCTCTCATCACCTCTTCCTTTGTAGGGTCCTTGATGCTTCC
JMSF044P12+ TTTGTAGGGTCCTTGATGCTTCC
                      ____________________________________________________________
consensus GTGTTCATACCCAGGTTTACCTCTCATCACCTCTTCCTTTGTAGGGTCCTTGATGCTTCC
 
. : . : . : . : . : . :
rJMSF020I08- ACGCCCTCTTATCAAAACGCGGCAGTCAGTACTTACTTCCACTCGCTTAAGGGAGTTTCC
rJMSF040O02- ACGCCCTCTTATCAAAACGCGGCAGTCAGTACTTACTTCCACTCGCTTAAGGGAGTTTCC
JMSF044P12+ ACGCCCTCTTATCAAAACGCGGCAGTCAGTACTTACTTCCACTCGCTTAAGGGAGTTTCC
                      ____________________________________________________________
consensus ACGCCCTCTTATCAAAACGCGGCAGTCAGTACTTACTTCCACTCGCTTAAGGGAGTTTCC
 
. : . : . : . : . : . :
rJMSF020I08- TCT
rJMSF040O02- TCTGGGACCAAGGAGACGTCCAACAAAATTGTAATTGGGATATTGCTCCACAGGTATATC
JMSF044P12+ TCTGGGACCAAGGAGACGTCCAACAAAATTGTAATTGGGATATTGCTCCACAGGTATATC
JMSF040O02+ ACCAAGGAGACGTCCAACAAAATTGTAATTGGGATATTGCTCCACAGGTATATC
JMFN040H04+ GACGTCCAACAAAATGTAATTTGGGATATTGCTCCACAGGTATATC
JMSF020I08+ ACCAAGGAGACGTCCAACAAAATTGTAATTGGGATATTGCTCCACAGGTATATC
                      ____________________________________________________________
consensus TCTGGGACCAAGGAGACGTCCAACAAAATTGTAATTGGGATATTGCTCCACAGGTATATC
 
. : . : . : . : . : . :
rJMSF040O02- AATTTCTGATGGTCTGCTTAACTATAAGTCCCGATGAGCTACTTTGACTACCAAGCCAGC
JMSF044P12+ AA-TTCTGATGGTCTGCTTAACTATAAGTCCCGATGAGCTACTTTGACTACCAAGCCAGC
JMSF040O02+ AA-TTCTGATGGTCTGCTTAACTATAAGTCCCGATGAGCTACTTTGACTACCAAGCCAGC
JMFN040H04+ AA-TTCTGATGGTCTGCTTAACTATAAGTCCCGATGAGCTACTTTGACTACCAAGCCAGC
JMSF020I08+ AA-TTCTGATGGTCTGCTTAACTATAAGTCCCGATGAGCTACTTTGACTACCAAGCCAGC
                      ____________________________________________________________
consensus AA-TTCTGATGGTCTGCTTAACTATAAGTCCCGATGAGCTACTTTGACTACCAAGCCAGC
 
. : . : . : . : . : . :
rJMSF040O02- TTTGTGCA
JMSF044P12+ TTTGTGCAGAAGAAGACTGCACCAAACCTGACATTTCGGATTGAAATGGTGATGACCATC
JMSF040O02+ TTTGTGCAGAAGAAGACTGCACCAAACCTGACATTTCGGATTGAAATGGTGATGACCATC
JMFN040H04+ TTTGTGCAGAAGAAGACTGCACCAAACCTGACATTTCGGATTGAAATGGTGATGACCATC
JMSF020I08+ TTTGTGCAGAAGAAGACTGCACCAAACCTGACATTTCGGATTGAAATGGTGATGACCATC
                      ____________________________________________________________
consensus TTTGTGCAGAAGAAGACTGCACCAAACCTGACATTTCGGATTGAAATGGTGATGACCATC
 
. : . : . : . : . : . :
JMSF044P12+ TGTCCTTGTTAGCACCTCCATTTGAAAACAGTCCTCCTGAAGCCAAGGGGCTACCATGTT
JMSF040O02+ TGTTCTTGTTAGCACCTCCATTTGAAAACAGTCCTCCTGAAGCCAAGGGGCTACCATGTT
JMFN040H04+ TGTCCTTGTTAGCACCTCCATTTGAAAACAGTCCTCCTGAAGCCAAGGGGCTACCATGTT
JMSF020I08+ TGTCCTTGTTAGCACCTCCATTTGAAAACAGTCCTCCTGAAGCCAAGGGGCTACCATGTT
                      ____________________________________________________________
consensus TGTCCTTGTTAGCACCTCCATTTGAAAACAGTCCTCCTGAAGCCAAGGGGCTACCATGTT
 
. : . : . : . : . : . :
JMSF044P12+ CAAGCCCACTTTGATCTAAAACAGATGCATTCCCCAAGAGTGTAGTTACACGAAGTATTT
JMSF040O02+ CAAGCCCACTTTGATCTAAAACAGATGCATTCCCCAAGAGTGTAGTTACACGAAGTATTT
JMFN040H04+ CAAGCCCACTTTGATCTAAAACAGATGCATTCCCCAAGAGTGTAGTTACACGAAGTATTT
JMSF020I08+ CAAGCCCACTTTGATCTAAAACAGATGCATTCCCCAAGAGTGTAGTTACACGAAGTATTT
                      ____________________________________________________________
consensus CAAGCCCACTTTGATCTAAAACAGATGCATTCCCCAAGAGTGTAGTTACACGAAGTATTT
 
. : . : . : . : . : . :
JMSF044P12+ CCTGGTTTAGCAACCGAAAGCAATTAGGAAGCACAGGCATAAAAGGACTGAGTTTGCTAC
JMSF040O02+ CCTGGTTTAGCAACCGAAAGCAATTAGGAAGCACAGGCATAAAAGGACTGAGTTTGCTAC
JMFN040H04+ CCTGGTTTAGCAACCGAAAGCAATTAGGAAGCACAGGCATAAAAGGACTGAGTTTGCTAC
JMSF020I08+ CCTGGTTTAGCAACCGAAAGCAATTAGGAAGCACAGGCATAAAAGGACTGAGTTTGCTAC
                      ____________________________________________________________
consensus CCTGGTTTAGCAACCGAAAGCAATTAGGAAGCACAGGCATAAAAGGACTGAGTTTGCTAC
 
. : . : . : . : . : . :
JMSF044P12+ GTTCAGCAAGCAACTCCGCAAGATACTTCTCTTGCTCGACGAGGGCAGAGGAAGCGGAGC
JMSF040O02+ GTTCAGCAAGCAACTCCGCAAGATACTTCTCTTGCTCGACGAGGGCAGAGGAAGCGGAGC
JMFN040H04+ GTTCAGCAAGCAACTCCGCAAGATACTTCTCTTGCTCGACGAGGGCAGAGGAAGCGGAGC
JMSF020I08+ GTTCAGCAAGCAACTCCGCAAGATACTTCTCTTGCTCGACGAGGGCAGAGGAAGCGGAGC
                      ____________________________________________________________
consensus GTTCAGCAAGCAACTCCGCAAGATACTTCTCTTGCTCGACGAGGGCAGAGGAAGCGGAGC
 
. : . : . : . : . : . :
JMSF044P12+ GGAGAGCGCCGATGTGAGGAGAGTGAGGGGCGGAGGGTGAAGGCGAGTACGCCATAAACC
JMSF040O02+ GGAGAGCGCCGATGTGAGGAGAGTGAGGGGCGGAGGGTGAAGGCGAGTACGCCATAAACC
JMFN040H04+ GGAGAGCGCCGATGTGAGGAGAGTGAGGGGCGGAGGGTGAAGGCGAGTACGCCATAAACC
JMSF020I08+ GGAGAGCGCCGATGTGAGGAGAGTGAGGGGCGGAGGGTGAAGGCGAGTACGCCATAAACC
                      ____________________________________________________________
consensus GGAGAGCGCCGATGTGAGGAGAGTGAGGGGCGGAGGGTGAAGGCGAGTACGCCATAAACC
 
. : . : . : . : . : . :
JMSF044P12+ TGCTAGAAGCCATCTGTTTGGAGGTGAATATTGGAAAGAGCAGATTCACCTTGCACCGCC
JMSF040O02+ TGCTAGAAGCCATCTGTTTGGAGGTGAATATTGGAAAGAGCAGATTCACCTTGCACCGCC
JMFN040H04+ TGCTAGAAGCCATCTGTTTGGAGGTGAATATTGGAAAGAGCAGATTCACCTTGCACCGCC
JMSF020I08+ TGCTAGAAGCCATCTGTTTGGAGGTGAATATTGGAAAGAGCAGATTCACCTTGCACCGCC
                      ____________________________________________________________
consensus TGCTAGAAGCCATCTGTTTGGAGGTGAATATTGGAAAGAGCAGATTCACCTTGCACCGCC
 
. : . : . : . : . : . :
JMSF044P12+ GCTAACAGCCTCCGTTCTGGCGACAGAGATGATTGTGATCGATAGCCGGAGACTATAATC
JMSF040O02+ GCTAACAGCCTCCGTTCTGGCGACAGAGATGATTGTGATCGATAGCCGGAGACTATAATC
JMFN040H04+ GCTAACAGCCTCCGTTCTGGCGACAGAGATGATTGTGATCGATAGCCGGAGACTATAATC
JMSF020I08+ GCTAACAGCCTCCGTTCTGGCGACAGAGATGATTGTGATCGATAGCCGGAGACTATAATC
                      ____________________________________________________________
consensus GCTAACAGCCTCCGTTCTGGCGACAGAGATGATTGTGATCGATAGCCGGAGACTATAATC
 
. : . : . : . : . : . :
JMSF044P12+ GCGTCGGT
JMSF040O02+ GCGTCGGTGGAGAAAATTGTTCAACAGACCCACCACCACTCGTACATACGTTTCTA
JMFN040H04+ GCGTCGGTGGAGAAAATTGTTCAACAGACCCACCACCAC
JMSF020I08+ GCGTCGGTGGAGAAAATTGTTCAACAGACCCACCACCACTCGTACATACGTTTCTACTCC
                      ____________________________________________________________
consensus GCGTCGGTGGAGAAAATTGTTCAACAGACCCACCACCACTCGTACATACGTTTCTACTCC