Previous Contig 005893:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021N21Sequence567005893 (2)gb:AB030565_15185179e-53Arabidopsis thaliana CAO gene for chlorophyll a oxygenase, complete cds.>gb:AY12746009235 (2)gb:AF177200_17746313e-50Arabidopsis thaliana chlorophyll a oxygenase (CAO) gene, complete cds.
JMSF020G10Sequence281005893 (2)gb:AF177200_17746310.001Arabidopsis thaliana chlorophyll a oxygenase (CAO) gene, complete cds.728009235 (2)gb:AF177200_17746312e-54Arabidopsis thaliana chlorophyll a oxygenase (CAO) gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF021N21+ ATGTGAGCCAGCTTATCTAGGGCAGAAGAAACTCTAGCCTCAG
                      ____________________________________________________________
consensus ATGTGAGCCAGCTTATCTAGGGCAGAAGAAACTCTAGCCTCAG
 
. : . : . : . : . : . :
JMFF021N21+ AGATGTGTACCTGTTTATGAGCTTGTGTGAGTGCTTCTTGCAAACCTGCAAGTTCCTTCT
                      ____________________________________________________________
consensus AGATGTGTACCTGTTTATGAGCTTGTGTGAGTGCTTCTTGCAAACCTGCAAGTTCCTTCT
 
. : . : . : . : . : . :
JMFF021N21+ TCATTGTTCCAATAGATTTATAGTCACGGGCTAGAGGGTTTAATACTTCCACAACCTTCT
                      ____________________________________________________________
consensus TCATTGTTCCAATAGATTTATAGTCACGGGCTAGAGGGTTTAATACTTCCACAACCTTCT
 
. : . : . : . : . : . :
JMFF021N21+ CGTGCAGAAGCATGATCGTAAGAACATCTTGACGAGCTTTCCAATCACAATACTGTATAT
                      ____________________________________________________________
consensus CGTGCAGAAGCATGATCGTAAGAACATCTTGACGAGCTTTCCAATCACAATACTGTATAT
 
. : . : . : . : . : . :
JMFF021N21+ CATATCGAGCCACTTCTAAAGCTGTATTTACATCTAGGAACTTGCCTTTACATTGGGGAA
                      ____________________________________________________________
consensus CATATCGAGCCACTTCTAAAGCTGTATTTACATCTAGGAACTTGCCTTTACATTGGGGAA
 
. : . : . : . : . : . :
JMFF021N21+ CTTTGGACCTTGGATCTTCTACATTAAAAAGTGTCAGCCATGGGCTTTTCTTGTCTACTA
JMSF020G10+ TACATTAAAAAGTGTCAGCCATGGGCTTTTCTTGTCTACTA
                      ____________________________________________________________
consensus CTTTGGACCTTGGATCTTCTACATTAAAAAGTGTCAGCCATGGGCTTTTCTTGTCTACTA
 
. : . : . : . : . : . :
JMFF021N21+ ACCCGCCCTCCTCCCCATACATAGCAAACACTCCAAATCCTCCACGGACATACTTCTTAG
JMSF020G10+ ACCCGCCCTCCTCCCCATACATAGCAAACACTCCAAATCCTCCACGGACATACTTCTTAG
                      ____________________________________________________________
consensus ACCCGCCCTCCTCCCCATACATAGCAAACACTCCAAATCCTCCACGGACATACTTCTTAG
 
. : . : . : . : . : . :
JMFF021N21+ AGTAAGACTTAGAGGAATGGGATGAAGAGAAAGGAAGACAGAGAGCAGTAGCAATGGCGG
JMSF020G10+ AGTAAGACTTAGAGGAATGGGATGAAGAGAAAGGAAGNCAGAGAGCAGTAGCAATGGCGG
                      ____________________________________________________________
consensus AGTAAGACTTAGAGGAATGGGATGAAGAGAAAGGAAGACAGAGAGCAGTAGCAATGGCGG
 
. : . : . : . : . : . :
JMFF021N21+ CGGAGGACATGGTGAGGCGGCGGAATTTCAGCTTCTAAAACA-GCCGGCGACGGAGGATT
JMSF020G10+ CGGAGGACATGGTGAGGCGGCGGAATTTCAGCTTCTAAAACACGCCGGCGACGGAGGATT
                      ____________________________________________________________
consensus CGGAGGACATGGTGAGGCGGCGGAATTTCAGCTTCTAAAACACGCCGGCGACGGAGGATT
 
. : . : . : . : . : . :
JMFF021N21+ AAGAGCTGCCGCGAAGAGACTGAGAGAGCGATGGAGTCAAAACTC
JMSF020G10+ AAGAGCTGCCGCGAAGAGACTGAGAGAGCGANGGAGTCAAAACTCAAAATTTCCTTNGTC
                      ____________________________________________________________
consensus AAGAGCTGCCGCGAAGAGACTGAGAGAGCGATGGAGTCAAAACTCAAAATTTCCTTNGTC