Previous Contig 005885:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031G18Sequence568005885 (2)gb:AY321103_15990753e-57Nicotiana benthamiana C-4 sterol methyl oxidase 1 mRNA, partial cds.771021358gb:AF039199_17633217e-62Arabidopsis thaliana sterol-4-methyl-oxidase mRNA, complete cds.
JMSF020E22Sequence680005885 (2)gb:AY321103_15990754e-44Nicotiana benthamiana C-4 sterol methyl oxidase 1 mRNA, partial cds.660012124 (3)pir|T06618|T066182e-15hypothetical protein F16J13.180 - Arabidopsis thaliana>gb:ATCHRIV33_1544976 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF031G18+ ATCTTCTCGTACC
                      ____________________________________________________________
consensus ATCTTCTCGTACC
 
. : . : . : . : . : . :
JMFF031G18+ CCCATTTGCAATGCAAAAACCTGTGGATCCAATAGTTGGTGTAGTCCTCCACAAAGAAAT
                      ____________________________________________________________
consensus CCCATTTGCAATGCAAAAACCTGTGGATCCAATAGTTGGTGTAGTCCTCCACAAAGAAAT
 
. : . : . : . : . : . :
JMFF031G18+ ACACCATCAATTGGGCCGCAATTTCCCATATCGACGGCAAGGGCAAGCTCGTTCTTATCC
                      ____________________________________________________________
consensus ACACCATCAATTGGGCCGCAATTTCCCATATCGACGGCAAGGGCAAGCTCGTTCTTATCC
 
. : . : . : . : . : . :
JMFF031G18+ CAATCATTTTGATAGAGGGATACGATACGAGCTGGAGAGGGCCGACGACGAGGATGAACA
JMSF020E22+ TTTGATAGAGGGATACGATACGAGTTGGAGAGGGCCGACGACGAGAATGAACA
                      ____________________________________________________________
consensus CAATCATTTTGATAGAGGGATACGATACGAGTTGGAGAGGGCCGACGACGAGGATGAACA
 
. : . : . : . : . : . :
JMFF031G18+ TGCGCATGACTGATTTGTAGCAGCGGAAGGAATCGGAGAGGGTGAGATTGACTTTTGGTT
JMSF020E22+ TGCGCATGACTGATTTGTAGCAGCGGAAGGATTCAGAGAGGGTGAGATTGACTTTTGGTT
                      ____________________________________________________________
consensus TGCGCATGACTGATTTGTAGCAGCGGAAGGATTCGGAGAGGGTGAGATTGACTTTTGGTT
 
. : . : . : . : . : . :
JMFF031G18+ GAATCTTGTAGGAATGGATATACTTTTCCAGGAAAAATTCGAGGAATAGGTAGTAGAGAG
JMSF020E22+ GAAGCTTGTAGGAGCGGATATAGTTCTTCAGGAAAAATTCAAGGAAGTAGTAGTAGAGAG
                      ____________________________________________________________
consensus GAATCTTGTAGGAGTGGATATAGTTTTTCAGGAAAAATTCGAGGAATTGGTAGTAGAGAG
 
. : . : . : . : . : . :
JMFF031G18+ GGATCAAGGAGAAGATGAGGAAAAGGAAGAGGATATTGTGGCAGTAGAGGAAGTAGTCGG
JMSF020E22+ GGACAAAGGAGAATATGAGGAAGAGGAAGAGGATATTGTGGCAGTAGAGGAAGTAGTCAG
                      ____________________________________________________________
consensus GGATCAAGGAGAATATGAGGAAGAGGAAGAGGATATTGTGGCAGTAGAGGAAGTAGTCGG
 
. : . : . : . : . : . :
JMFF031G18+ ATTTGGTGGCGGAGTAGTTGAACCAGATTGTCTCCGCGACCGTGAGGGATCGGCCCACGG
JMSF020E22+ ATTTGGTGGCTGAGTAGTTGAACCAGATTGTCTCCACGCCCGTGAGGGGTCGGCCCAGGG
                      ____________________________________________________________
consensus ATTTGGTGGCTGAGTAGTTGAACCAGATTGTCTCCGCGCCCGTGAGGGGTCGGCCCAGGG
 
. : . : . : . : . : . :
JMFF031G18+ CGACTTCCGCCTCCTGTATGGTGGCGTATGGCAGCAT
JMSF020E22+ TGGCTTCTGCCTCTTGTATGGTGGCGTACGGCAGCATACTAGATGCAGTTAAGCTGTGTT
                      ____________________________________________________________
consensus TGGCTTCTGCCTCTTGTATGGTGGCGTATGGCAGCATACTAGATGCAGTTAAGCTGTGTT
 
. : . : . : . : . : . :
JMSF020E22+ GAGACTTGCGAGGGTTTAGAGGCGGAACTGTGGCGTTGATGGGGAGATTGGGAGAGAATG
                      ____________________________________________________________
consensus GAGACTTGCGAGGGTTTAGAGGCGGAACTGTGGCGTTGATGGGGAGATTGGGAGAGAATG
 
. : . : . : . : . : . :
JMSF020E22+ CCGCTGATTTCAATGGGGAGATTGGATAAATTGGTAAACGACTATTTATTTACACAAATG
                      ____________________________________________________________
consensus CCGCTGATTTCAATGGGGAGATTGGATAAATTGGTAAACGACTATTTATTTACACAAATG
 
. : . : . : . : . : . :
JMSF020E22+ TATGAGGTAGAATGCGATGTAGCAGACGGTAGCCGACTAGCTGGCTGTTGGAACGAAGTG
                      ____________________________________________________________
consensus TATGAGGTAGAATGCGATGTAGCAGACGGTAGCCGACTAGCTGGCTGTTGGAACGAAGTG
 
. : . : . : . : . : . :
JMSF020E22+ GCCGCCGGGCAGAGAGATTTGGTCTGAGGAGAAGCTATGAGTGCAGGCTGCAGCTAGCCC
                      ____________________________________________________________
consensus GCCGCCGGGCAGAGAGATTTGGTCTGAGGAGAAGCTATGAGTGCAGGCTGCAGCTAGCCC