Previous Contig 005882:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027A06Sequence490005882 (14)gb:CTRCYC07A_16742454e-59Catharanthus roseus cyc07 gene, exon1-7, complete cds.701005882 (14)sp|P33444|RS3A_CATRO2e-9440S ribosomal protein S3a (CYC07 protein).
JMFF034E21Sequence572005882 (14)gb:CTRCYC07A_16742453e-74Catharanthus roseus cyc07 gene, exon1-7, complete cds.709005882 (14)sp|P33444|RS3A_CATROe-10040S ribosomal protein S3a (CYC07 protein).
JMSF004B09Sequence213005882 (14)gb:CTRCYC07A_16742457e-05Catharanthus roseus cyc07 gene, exon1-7, complete cds.122004588 (33)
JMSF011O18Sequence248005882 (14)pir|S42540|S425402e-13ribosomal protein S3a - rice>gb:RICT151_1703794 Oryza sativa mRNA for cyc07, com784005882 (14)sp|P33444|RS3A_CATROe-11940S ribosomal protein S3a (CYC07 protein).
JMSF015N15Sequence501005882 (14)gb:CTRCYC07A_16742453e-58Catharanthus roseus cyc07 gene, exon1-7, complete cds.722005882 (14)sp|P33444|RS3A_CATROe-10440S ribosomal protein S3a (CYC07 protein).
JMSF020E15Sequence257005882 (14)sp|P33444|RS3A_CATRO2e-0740S ribosomal protein S3a (CYC07 protein).204005882 (14)sp|P33444|RS3A_CATRO2e-0740S ribosomal protein S3a (CYC07 protein).
JMSF025C18Sequence648005882 (14)pir|S46496|JQ09395e-86ribosomal protein S3a - Madagascar periwinkle>gb:CTRCYC07_1674244 Catharanthus r765005882 (14)sp|P33444|RS3A_CATROe-10440S ribosomal protein S3a (CYC07 protein).
JMSF052O23Sequence610020630gb:AF133675_17709443e-84Populus tremula x Populus tremuloides retinoblastoma-related protein 1 (RB1) mRN922005882 (14)sp|P33444|RS3A_CATROe-12140S ribosomal protein S3a (CYC07 protein).

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF004B09- GAGGGCAAGTTGAGCTGACGGAACTCTTTGCATCTCTCTACGCA
JMFF027A06- AGGGCAAGTTGAGCTGACGGAACTCTTTGCATCTCTCTACGCA
JMFF034E21- AGGGCAAGTTGAGCTGACGGAACTCTTTGCATCTCTCTACGCA
                      ____________________________________________________________
consensus GAGGGCAAGTTGAGCTGACGGAACTCTTTGCATCTCTCTACGCA
 
. : . : . : . : . : . :
JMSF004B09- CCTTAGCTCCAAACCTCGACCATGG-CCGTCGGAAAGAACAAGCGGATTTCCAAGGGGAA
JMSF011O18- CTCGACCATGG-CCGTCGGAAAGAACAAGCGGATTTCCAAGGGGAA
JMFF027A06- CCTTAGCTCCAAACCTCGACCATGG-CCGTCGGAAAGAACAAGCGGATTTCCAAGGGGAA
JMSF015N15- CTCGACCATGG-CCGTCGGAAAGAACAAGCGGATTTCCAAGGGGAA
JMFF034E21- CCTTAGCTCCAAACCTCGACCATGG-CCGTCGGAAAGAACAAGCGGATTTCCAAGGGGAA
JMSF025C18- CTCGACCATGG-CCGTCGGAAAGAACAAGCGGATTTCCAAGGGGAA
rJMSF052O23+ ACCTCGACCATGGCCCGTCGGAAAGAACAAGCGGATTTCCAAGGGGAA
                      ____________________________________________________________
consensus CCTTAGCTCCAAACCTCGACCATGG-CCGTCGGAAAGAACAAGCGGATTTCCAAGGGGAA
 
. : . : . : . : . : . :
JMSF004B09- GAAAGGAGGAAAGAAGAAAGCAGCTGATCCCTTCGCCAAGAAGGACTGGTATGACATCAA
JMSF011O18- GAAA-GAGGAAAGAAGAAAGCAGCTGATCCCTTCGCCAAGAAGGACTGGTATGACATCAA
JMFF027A06- GAAAGGAGGAAAGAAGAAAGCAGCTGATCCCTTCGCCAAGAAGGACTGGTATGACATCAA
JMSF015N15- GAAAGGAGGAAAGAAGAAAGCAGCTGATCCCTTCGCCAAGAAGGACTGGTATGACATCAA
JMFF034E21- GAAAGGAGGAAAGAAGAAAGCAGCTGATCCCTTCGCCAAGAAGGACTGGTATGACATCAA
rJMSF011O18+ GTATGACATCAA
JMSF025C18- GAAAGGAGGAAAGAAGAAAGCAGCTGATCCCTTCGCCAAGAAGGACTGGTATGACATCAA
rJMSF052O23+ GAAAGGAGGAAAGAAGAAAGCAGCTGATCCCTTCGCCAAGAAGGACTGGTATGACATCAA
                      ____________________________________________________________
consensus GAAAGGAGGAAAGAAGAAAGCAGCTGATCCCTTCGCCAAGAAGGACTGGTATGACATCAA
 
. : . : . : . : . : . :
JMSF004B09- GGCTCCATCAGTTTTCACTGTAAGAAACATCGGAAAGACACTCGTTACCC
JMSF011O18- GGCTCCATCAGTTTTCACTGTAAGAAACATCGGAAAGACACTCGTTACCCGAACTCAGGG
JMFF027A06- GGCTCCATCAGTTTTCACTGTAAGAAACATCGGAAAGACACTCGTTACCCGAACTCAGGG
JMSF015N15- GGCTCCATCAGTTTTCACTGTAAGAAACATCGGAAAGACACTCGTTACCCGAACTCAGGG
JMFF034E21- GGCTCCATCAGTTTTCACTGTAAGAAACATCGGAAAGACACTCGTTACCCGAACTCAGGG
rJMSF011O18+ GGCTCCATCAGTTTTCACTGTAAGAAACATCGGAAAGACACTCGTTACCCGAACTCAGGG
JMSF025C18- GGCTCCATCAGTTTTCACTGTAAGAAACATCGGAAAGACACTCGTTACCCGAACTCAGGG
rJMSF052O23+ GGCTCCATCAGTTTTCACTGTAAGAAACATCGGAAAGACACTCGTTACCCGAACTCAGGG
                      ____________________________________________________________
consensus GGCTCCATCAGTTTTCACTGTAAGAAACATCGGAAAGACACTCGTTACCCGAACTCAGGG
 
. : . : . : . : . : . :
JMSF011O18- AACAAAGATTGCTTCA
JMFF027A06- AACAAAGATTGCTTCAGAAGGTCTCAAGCATCGTGTGTTTGAGGTGTCATTGGCTGACCT
JMSF015N15- AACAAAGATTGCTTCAGAAGGTCTCAAGCATCGTGTGTTTGAGGTGTCATTGGCTGACCT
JMFF034E21- AACAAAGATTGCTTCAGAAGGTCTCAAGCATCGTGTGTTTGAGGTGTCATTGGCTGACCT
rJMSF025C18+ TGCTTCAGAAGGTCTCAAGCATCGTGTGTTTGAGGTGTCATTGGCTGACCT
rJMSF011O18+ AACAAAGATTGCTTCAGAAGGTCTCAAGCATCGTGTGTTTGAGGTGTCATTGGCTGACCT
rJMSF015N15+ TGCTTCAGAAGGTCTCAAGCATCGTGTGTTTGAGGTGTCATTGGCTGACCT
JMSF025C18- AACAAAGATTGCTTCAGAAGGTCTCAAGCATCGTGTGTTTGAGGTGTCATTGGCTGACCT
rJMSF052O23+ AACAAAGATTGCTTCAGAAGGTCTCAAGCATCGTGTGTTTGAGGTGTCATTGGCTGACCT
rJMFF034E21+ CGTGTGTTTGAGGTGTCATTGGCTGACNT
                      ____________________________________________________________
consensus AACAAAGATTGCTTCAGAAGGTCTCAAGCATCGTGTGTTTGAGGTGTCATTGGCTGACCT
 
. : . : . : . : . : . :
JMFF027A06- CCAAGGTGATGAGGACCATGCTTTCAGAAAGATTCGTCTCAGGGCTGAGGATGTTCAGGG
JMSF015N15- CCAAGGTGATGAGGACCATGCTTTCAGAAAGATTCGTCTCAGGGCTGAGGATGTTCAGGG
JMFF034E21- CCAAGGTGATGAGGACCATGCTTTCAGAAAGATTCGTCTCAGGGCTGAGGATGTTCAGGG
rJMSF025C18+ CCAAGGTGATGAGGACCATGCTTTCAGAAAGATTCGTCTCAGGGCTGAGGATGTTCAGGG
rJMSF011O18+ CCAAGGTGATGAGGACCATGCTTTCAGAAAGATTCGTCTCAGGGCTGAGGATGTTCAGGG
rJMSF015N15+ CCAAGGTGATGAGGACCATGCTTTCAGAAAGATTCGTCTCAGGGCTGAGGATGTTCAGGG
JMSF025C18- CCAAGGTGATGAGGACCATGCTTTCAGAAAGATTCGTCTCAGGGCTGAGGATGTTCAGGG
rJMSF052O23+ CCAAGGTGATGAGGACCATGCTTTCAGAAAGATTCGTCTCAGGGCTGAGGATGTTCAGGG
rJMFF027A06+ GTGATGAGGACCATGCTTTCAGAAAGATTCGTCTCAGGGCTGAGGATGTTCAGGG
rJMFF034E21+ CCAAGGTGATGAGGACCATGCTTTCAGAAAGATTCGTCTCAGGGCTGAGGATGTTCAGGG
                      ____________________________________________________________
consensus CCAAGGTGATGAGGACCATGCTTTCAGAAAGATTCGTCTCAGGGCTGAGGATGTTCAGGG
 
. : . : . : . : . : . :
JMFF027A06- AAGAAATGTCCTTACAAACTTTTGGGGAATGAACTTCACTACAGATAAATTGAGGTCATT
JMSF015N15- AAGAAATGTCCTTACAAACTTTTGGGGAATGAACTTCACTACAGATAAATTGAGGTCATT
JMFF034E21- AAGAAATGTCCTTACAAACTTTTGGGGAATGAACTTCACTACAGATAAATTGAGGTCATT
rJMSF025C18+ AAGAAATGTCCTTACAAACTTTTGGGGAATGAACTTCACTACAGATAAATTGAGGTCATT
rJMSF011O18+ AAGAAATGTCCTTACAAACTTTTGGGGAATGAACTTCACTACAGATAAATTGAGGTCATT
rJMSF015N15+ AAGAAATGTCCTTACAAACTTTTGGGGAATGAACTTCACTACAGATAAATTGAGGTCATT
JMSF025C18- AAGAAATGTCCTTACAAACTTTTGGGGAATGAACTTCACTACAGATAAATTGAGGTCATT
rJMSF052O23+ AAGAAATGTCCTTACAAACTTTTGGGGAATGAACTTCACTACAGATAAATTGAGGTCATT
rJMFF027A06+ AAGAAATGTCCTTACAAACTTTTGGGGAATGAACTTCACTACAGATAAATTGAGGTCATT
rJMFF034E21+ AAGAAATGTCCTTACAAACTTTTGGGGAATGAACTTCACTACAGATAAATTGAGGTCATT
                      ____________________________________________________________
consensus AAGAAATGTCCTTACAAACTTTTGGGGAATGAACTTCACTACAGATAAATTGAGGTCATT
 
. : . : . : . : . : . :
JMFF027A06- GGTGAAGAAGTGGCAATCACTGATTGAGGCACATGTTGATGTTAAAACAACAGACAGCTA
JMSF015N15- GGTGAAGAAGTGGCAATCACTGATTGAGGCACATGTTGATGTTAAAACAACAGACAGCTA
JMFF034E21- GGTGAAGAAGTGGCAATCACTGATTGAGGCACATGTTGATGTTAAAACAACAGACAGCTA
rJMSF025C18+ GGTGAAGAAGTGGCAATCACTGATTGAGGCACATGTTGATGTTAAAACAACAGACAGCTA
rJMSF011O18+ GGTGAAGAAGTGGCAATCACTGATTGAGGCACATGTTGATGTTAAAACAACAGACAGCTA
rJMSF015N15+ GGTGAAGAAGTGGCAATCACTGATTGAGGCACATGTTGATGTTAAAACAACAGACAGCTA
JMSF025C18- GGTGAAGAAGTGGCAATCACTGATTGAGGCACATGTTGATGTTAAAACAACAGACAGCTA
rJMSF052O23+ GGTGAAGAAGTGGCAATCACTGATTGAGGCACATGTTGATGTTAAAACAACAGACAGCTA
rJMFF027A06+ GGTGAAGAAGTGGCAATCACTGATTGAGGCACATGTTGATGTTAAAACAACAGACAGCTA
rJMFF034E21+ GGTGAAGAAGTGGCAATCACTGATTGAGGCACATGTTGATGTTAAAACAACAGACAGCTA
                      ____________________________________________________________
consensus GGTGAAGAAGTGGCAATCACTGATTGAGGCACATGTTGATGTTAAAACAACAGACAGCTA
 
. : . : . : . : . : . :
JMFF027A06- TACCTTGAGAATGTTTTGCATTGGCTTC
JMSF015N15- TACCTTGAGAATGNTTTGCATTGGCTTCA
JMFF034E21- TACCTTGAGAATGTTTTGCATTGGCTTCACTAAGAAGAGAGTAAACCAGCAAAAGAGAAC
rJMSF025C18+ TACCTTGAGAATGTTTTGCATTGGCTTCACTAAGAAGAGAGTAAACCAGCAAAAGAGAAC
rJMSF011O18+ TACCTTGAGAATGTTTTGCATTGGCTTCACTAAGAAGAGAGTAAACCAGCAAAAGAGAAC
rJMSF015N15+ TACCTTGAGAATGTTTTGCATTGGCTTCACTAAGAAGAGAGTAAACCAGCAAAAGAGAAC
JMSF025C18- TACCTTGAGAATGTTTTGCATTGGCTTCACTAAGAAGAGAGTAAACCAGCAAAAGAGAAC
rJMSF052O23+ TACCTTGAGAATGTTTTGCATTGGCTTCACTAAGAAGAGAGTAAACCAGCAAAAGAGAAC
rJMFF027A06+ TACCTTGAGAATGTTTTGCATTGGCTTCACTAAGAAGAGAGTAAACCAGCAAAAGAGAAC
rJMFF034E21+ TACCTTGAGAATGTTTTGCATTGGCTTCACTAAGAAGAGAGTAAACCAGCAAAAGAGAAC
                      ____________________________________________________________
consensus TACCTTGAGAATGTTTTGCATTGGCTTCACTAAGAAGAGAGTAAACCAGCAAAAGAGAAC
 
. : . : . : . : . : . :
JMFF034E21- CTGCTATGCACAATCTAGCCAGATTCGTCAGATTCGCCGCAAGATGCGGG
rJMSF025C18+ CTGCTATGCACAATCTAGCCAGATTCGTCAGATTCGCCGCAAGATGCGGGAGATTATGGT
rJMSF011O18+ CTGCTATGCACAATCTAGCCAGATTCGTCAGATTCGCCGCAAGATGCGGGAGATTATGGT
rJMSF015N15+ CTGCTATGCACAATCTAGCCAGATTCGTCAGATTCGCCGCAAGATGCGGGAGATTATGGT
JMSF025C18- CTGCTATGCACAATCTAGCCAGATTCGTCAGATTCGCCGCAAGATGCGGGAGATTATGGT
rJMSF052O23+ CTGCTATGCACAATCTAGCCAGATTCGTCAGATTCGCCGCAAGATGCGGGAGATTATGGT
rJMFF027A06+ CTGCTATGCACAATCTAGCCAGATTCGTCAGATTCGCCGCAAGATGCGGGAGATTATGGT
rJMFF034E21+ CTGCTATGCACAATCTAGCCAGATTCGTCAGATTCGCCGCAAGATGCGGGAGATTATGGT
                      ____________________________________________________________
consensus CTGCTATGCACAATCTAGCCAGATTCGTCAGATTCGCCGCAAGATGCGGGAGATTATGGT
 
. : . : . : . : . : . :
rJMSF025C18+ TAACCATGCTCAGTCATGTGACCTCAAGGACTTGGTTCAGAAGTTCATTCCTGAGTCAAT
rJMSF011O18+ TAACCATGCTCAGTCATGTGACCTCAAGGACTTGGTTCAGAAGTTCATTCCTGAGTCAAT
rJMSF015N15+ TAACCATGCTCAGTCATGTGACCTCAAGGACTTGGTTCAGAAGTTCATTCCTGAGTCAAT
JMSF025C18- TAACCATGCTCAGTCATGTGACCTCAAGGACTTGGTTCAGAAGTTCATTCCTGAG
rJMSF052O23+ TAACCATGCTCAGTCATGTGACCTCAAGGACTTGGTTCAGAAGTTCATTCCTGAGTCAAT
rJMFF027A06+ TAACCATGCTCAGTCATGTGACCTCAAGGACTTGGTTCAGAAGTTCATTCCTGAGTCAAT
rJMFF034E21+ TAACCATGCTCAGTCATGTGACCTCAAGGACTTGGTTCAGAAGTTCATTCCTGAGTCAAT
                      ____________________________________________________________
consensus TAACCATGCTCAGTCATGTGACCTCAAGGACTTGGTTCAGAAGTTCATTCCTGAGTCAAT
 
. : . : . : . : . : . :
rJMSF025C18+ TGGCCGTGATATTGAGAAGGCCACCTCAAGCATCTACCCTTTACAAAATGTGTTCATTCG
rJMSF011O18+ TGGCCGTGATATTGAGAAGGCCACCTCAAGCATCTACCCTTTACAAAATGTGTTCATTCG
rJMSF015N15+ TGGCCGTGATATTGAGAAGGCCACCTCAAGCATCTACCCTTTACAAAATGTGTTCATTCG
rJMSF052O23+ TGGCCGTGATATTGAGAAGGCCACCTCAAGCATCTACCCTTTACAAAATGTGTTCATTCG
rJMFF027A06+ TGGCCGTGATATTGAGAAGGCCACCTCAAGCATCTACCCTTTACAAAATGTGTTCATTCG
rJMFF034E21+ TGGCCGTGATATTGAGAAGGCCACCTCAAGCATCTACCCTTTACAAAATGTGTTCATTCG
                      ____________________________________________________________
consensus TGGCCGTGATATTGAGAAGGCCACCTCAAGCATCTACCCTTTACAAAATGTGTTCATTCG
 
. : . : . : . : . : . :
rJMSF025C18+ CAAGGTCAAGATCCTAAAGGCTCCCAAGTTTGATCTTGGCAAGTTAATGGAGGTTCACGG
rJMSF011O18+ CAAGGTCAAGATCCTAAAGGCTCCCAAGTTTGATCTTGGCAAGTTAATGGAGGTTCACGG
rJMSF020E15+ GTTAATGGAGGTTCACGG
rJMSF015N15+ CAAGGTCAAGATCCTAAAGGCTCCCAAGTTTGATCTTGGCAAGTTAATGGAGGTTCACGG
rJMSF052O23+ CAAGGTCAAGATCCTAAAGGCTCCCAAGTTTGATCTTGGCAAGTTAATGGAGGTTCACGG
rJMFF027A06+ CAAGGTCAAGATCCTAAAGGCTCCCAAGTTTGATCTTGGCAAGTTAATGGAGGTTCACGG
rJMFF034E21+ CAAGGTCAAGATCCTAAAGGCTCCCAAGTTTGATCTTGGCAAGTTAATGGAGGTTCACGG
JMSF020E15- GTTAATGGAGGTTCACGG
                      ____________________________________________________________
consensus CAAGGTCAAGATCCTAAAGGCTCCCAAGTTTGATCTTGGCAAGTTAATGGAGGTTCACGG
 
. : . : . : . : . : . :
rJMSF025C18+ TGACTACACTGAAGATGTTGGCACAAAGCTGGACAGGCCTGC
rJMSF011O18+ TGACTACACTGAAGATGTTGGCACAAAGCTGGACAGGCCTGCAGATGAGCCCGTGGCTGA
rJMSF020E15+ TGACTACACTGAAGATGTTGGCACAAAGCTGGACAGGCCTGCAGATGAGCCCGTGGCTGA
rJMSF015N15+ TGACTACACTGAAGATGTTGGCACAAAGCTGGACAGGCCTGCAGATGAGCCCGTGGCTGA
rJMSF052O23+ TGACTACACTGAAGATGTTGGCACAAAGCTGGACAGGCCTGCAGATGAGCCCGTGGCTGA
rJMFF027A06+ TGACTACACTGAAGATGTTGGCACAAAGCTGGACAGGCCTGC
rJMFF034E21+ TGACTACACTGAAGATGTTGGCACAAAGCTGGACAGGCCTGCAGATGAGCCCGTGGCTGA
JMSF020E15- TGACTACACTGAAGATGTTGGCACAAAGCTGGACAGGCCTGCAGATGAGCCCGTGGCTGA
                      ____________________________________________________________
consensus TGACTACACTGAAGATGTTGGCACAAAGCTGGACAGGCCTGCAGATGAGCCCGTGGCTGA
 
. : . : . : . : . : . :
rJMSF011O18+ GGCAACTGAACCTGTTGTTGGAGCTTGATTGTGAATTTTGTGTCTTGTGCGTTTCTTGCC
rJMSF020E15+ GGCAACTGAACCTGTTGTTGGAGCTTGATTGTGAATTTTGTGTCTTGTGCGTTTCTTGCC
rJMSF015N15+ GGCAACTGAACCTGTTGTTGGAGCTTGATTGTGAATTTTGTGTCTTGTGCGTTTCTTGCC
rJMSF052O23+ GGCAACTGAACCTGTTGTTGGAGCTTGATTGTGAATTTTGTGTCTTGTGCGTTTCTTGCC
rJMFF034E21+ GGCAACTGAACCTGTTGTTGGAGCTTGATTGTGAATTTTGTGTCTTGTGCGTTTCTTGCC
JMSF020E15- GGCAACTGAACCTGTTGTTGGAGCTTGATTGTGAATTTTGTGTCTTGTGCGTTTCTTGCC
                      ____________________________________________________________
consensus GGCAACTGAACCTGTTGTTGGAGCTTGATTGTGAATTTTGTGTCTTGTGCGTTTCTTGCC
 
. : . : . : . : . : . :
rJMSF011O18+ TATTTATATGCTTTAATGGACCTTAGATCTTTGGCGGCTTAGGAAGAGTTT
rJMSF020E15+ TATTTATATGCTTTAATGGACCTTAGATCTTTGGCGGCTTAGGAAGAGTTTTGACCAGGC
rJMSF015N15+ TATTTATATGCTTTAATGGACCTTAGATCTTTGGCGGCTTAGGAAGAGTTTTGACCAGGC
rJMSF052O23+ TATTTATATGCTTTAATGGACCTTAGATCTTTGGCGGCTTAGGAAGAGTTTTGA-CAGGC
rJMFF034E21+ TATTTATATGCTTTAATGGACCTTAGATCTTTGGCGGCTTAGGAAGAGTTTTGA-CAGGC
JMSF020E15- TATTTATATGCTTTAATGGACCTTAGATCTTTGGCGGCTTAGGAAGAGTTTTGA-CAGGC
                      ____________________________________________________________
consensus TATTTATATGCTTTAATGGACCTTAGATCTTTGGCGGCTTAGGAAGAGTTTTGA-CAGGC
 
. : . : . : . : . : . :
rJMSF020E15+ ATATCT
rJMSF015N15+ ATATCTTGATA
rJMSF052O23+ ATATCTTGATACTGAACC
rJMFF034E21+ ATATCTTGATACTGAACCATT
JMSF020E15- ATATCTTGATACTGAACCATTTGAACTTGATGATGAACCAGTTTATATTTAAAAAAAAAA
                      ____________________________________________________________
consensus ATATCTTGATACTGAACCATTTGAACTTGATGATGAACCAGTTTATATTTAAAAAAAAAA