Previous Contig 005880:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020O21Sequence304005880 (3)gb:AY639146_16188445e-05Nicotiana tabacum proline oxidase/dehydrogenase 2 (PROX2) mRNA, complete cds.702009986 (3)gb:AB046419_15204956e-75Nicotiana tabacum cig1 mRNA, cytokinin inducible gene, complete cds.
JMSF020E13Sequence553005880 (3)gb:AY639146_16188442e-24Nicotiana tabacum proline oxidase/dehydrogenase 2 (PROX2) mRNA, complete cds.772009986 (3)gb:AY639146_16188446e-92Nicotiana tabacum proline oxidase/dehydrogenase 2 (PROX2) mRNA, complete cds.
JMSF027I06Sequence666005880 (3)gb:AY639146_16188441e-34Nicotiana tabacum proline oxidase/dehydrogenase 2 (PROX2) mRNA, complete cds.652001375 (31)pir|T51863|T518636e-76probable RNA binding protein [imported] - Arabidopsis thaliana>gb:ATRNABIND_1554

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF027I06+ AATCATGTAATAGNTG
                      ____________________________________________________________
consensus AATCATGTAATAGNTG
 
. : . : . : . : . : . :
JMSF027I06+ GATTGCACATTAATGATTATATTAAAGAAAGTTACGCAACTAATTAATATCTTACCGGCG
                      ____________________________________________________________
consensus GATTGCACATTAATGATTATATTAAAGAAAGTTACGCAACTAATTAATATCTTACCGGCG
 
. : . : . : . : . : . :
JMSF027I06+ GTAGAGACTTGGCGGAGTCGACGGTTTGAAGGATATCATTCATACTCCGATCACACGATT
                      ____________________________________________________________
consensus GTAGAGACTTGGCGGAGTCGACGGTTTGAAGGATATCATTCATACTCCGATCACACGATT
 
. : . : . : . : . : . :
JMSF027I06+ TTGTCGTGGGAGTGCTCCGACCCGTAATCCAGCATAGCCTTAATGCCGGTCTCCGACATG
JMSF020E13+ GGTCTCCGACATG
                      ____________________________________________________________
consensus TTGTCGTGGGAGTGCTCCGACCCGTAATCCAGCATAGCCTTAATGCCGGTCTCCGACATG
 
. : . : . : . : . : . :
JMSF027I06+ CCGGCGACGGTCCGGGCAACTTCCTCCAAATCCCTGCCGGCGCAAAATTGGCCGTAAAAC
JMSF020E13+ CCGGCGANGGTCCGGGCAACTTCCTCCAAATCCCTGCCGGCGCAAAATTGGCCGTAAAAC
                      ____________________________________________________________
consensus CCGGCGACGGTCCGGGCAACTTCCTCCAAATCCCTGCCGGCGCAAAATTGGCCGTAAAAC
 
. : . : . : . : . : . :
JMSF027I06+ GTACGCTCGACGAGACCCATCACCGTTTCCCGAACCACCGGAATCTCCATGAGCCGCGAA
JMSF020E13+ GTACGCTCGACGAGACCCATCACCGTTTCCCGAACCACCGGAATCTCCATGAGCCGCGAA
                      ____________________________________________________________
consensus GTACGCTCGACGAGACCCATCACCGTTTCCCGAACCACCGGAATCTCCATGAGCCGCGAA
 
. : . : . : . : . : . :
JMSF027I06+ TTCATCACCCGAATACCCGCGTCGACGGCGGGCTCGATTGCCAGCACGTGAAGCGCGACG
JMFF020O21+ TGAAGCGCGACG
JMSF020E13+ TTCATCACCCGAATACCCGCGTCGANGGCGGGCTCGATTGCCAGCACGTGAAGCGCGACG
                      ____________________________________________________________
consensus TTCATCACCCGAATACCCGCGTCGACGGCGGGCTCGATTGCCAGCACGTGAAGCGCGACG
 
. : . : . : . : . : . :
JMSF027I06+ GCGGATTTCACCAACTTCGACGTCCGCACCGACAAAAACAGCTCCTTGGCATCCTCAAAG
JMFF020O21+ GCGGATTTCACCAACTTCGACGTCCGCACCGACAAAAACAGCTCCTTGGCATCCTCAAAG
JMSF020E13+ GCGGATTTCACCAACTTCGACGTCCGCACCGACAAAAACAGCTCCTTGGCATCNTCAAAG
                      ____________________________________________________________
consensus GCGGATTTCACCAACTTCGACGTCCGCACCGACAAAAACAGCTCCTTGGCATCCTCAAAG
 
. : . : . : . : . : . :
JMSF027I06+ TCGAGGACCGATTTGGCGGCGGCGGCGGCGGGAGTTGGGTCGGGCTTTTCGGCAAAGTTG
JMFF020O21+ TCGAGGACNGATTTGGCGGCGGCGGCGGCGGGAGTTGGGTCGGGCTTTTCGGCAAAGTTG
JMSF020E13+ TCGAGGACCGATTTGGCGGCGGCGGCGGCGGGAGTTGGGTCGGGCTTTTCGGCAAAGTTG
                      ____________________________________________________________
consensus TCGAGGACCGATTTGGCGGCGGCGGCGGCGGGAGTTGGGTCGGGCTTTTCGGCAAAGTTG
 
. : . : . : . : . : . :
JMSF027I06+ AGCGGCGGCGGGAGTTGGGTGGTGAATGACGAGGGAGCCGAGTTCAGACGCCGGACGAAA
JMFF020O21+ AGCGGCGGCGGGAGTTGGGTGGTGAATGACGAGGGAGCCGAGTTCAGACGCCGGACGAAA
JMSF020E13+ AGCGGCGGCGGGAGTTGGGTGGTGAATGACGAGGGAGCCGAGTTCAGACGCCGGACGAAA
                      ____________________________________________________________
consensus AGCGGCGGCGGGAGTTGGGTGGTGAATGACGAGGGAGCCGAGTTCAGACGCCGGACGAAA
 
. : . : . : . : . : . :
JMSF027I06+ CGGGGCAGACTCTTCGCGATTTTTCCGGGATTCCCTACACGGCTTGCCATTAACGAAACC
JMFF020O21+ CGGGGCAGACTCTTCGCGATTTTTCCGGGATTCCCTACACGGCTTGCCATTAACGAAACC
JMSF020E13+ CGGGGCAGACTCTTAGCGATTTTTCCGGGATTCCCTACACGGCTTGCCATTAACGAAACC
                      ____________________________________________________________
consensus CGGGGCAGACTCTTCGCGATTTTTCCGGGATTCCCTACACGGCTTGCCATTAACGAAACC
 
. : . : . : . : . : . :
JMSF027I06+ GATCTTGATTCTTGTCTTCTTGATTCTCTCTCTCGTCCGATAAAAC
JMFF020O21+ GATCTTGATTCTTGTCTTCTTGATTCTCTCTCTCGTCCGATAAAAC
JMSF020E13+ GATCTTGATTCTTGTCTTCTTGATTCTCTCTCTCGTCCGATAAAACTGTAACAATATCCG
                      ____________________________________________________________
consensus GATCTTGATTCTTGTCTTCTTGATTCTCTCTCTCGTCCGATAAAACTGTAACAATATCCG
 
. : . : . : . : . : . :
JMSF020E13+ ATGAACTGCATCGACTATTTAACGAAGTCATTTAACTTATTATGATTCATGCACCCCACA
                      ____________________________________________________________
consensus ATGAACTGCATCGACTATTTAACGAAGTCATTTAACTTATTATGATTCATGCACCCCACA