Previous Contig 005873:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007P18Sequence565005873 (2)gb:AC105773_17382431e-44Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1562_H01, complete s714008523 (2)gb:BT005746_16386743e-51Arabidopsis thaliana clone RAFL15-31-L02 (R50087) unknown protein (At1g31500) mR
JMSF020D06Sequence590005873 (2)gb:AC105773_17382431e-44Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1562_H01, complete s789008523 (2)gb:BT005746_16386741e-65Arabidopsis thaliana clone RAFL15-31-L02 (R50087) unknown protein (At1g31500) mR

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF007P18+ GAATCATTTGTCGATTCATCACTTTTATTTCCACTAGCTGATAGATCA
JMSF020D06+ CTGAATCATTTGTCGATTCATCACTTTTATTTCCACTAGCTGATAGATCA
                      ____________________________________________________________
consensus CTGAATCATTTGTCGATTCATCACTTTTATTTCCACTAGCTGATAGATCA
 
. : . : . : . : . : . :
JMFF007P18+ ACATCTTTCTTCAGACTTGCAGCTTCATCTTGAATTGAATTTAAAAGATCATTGTAATCT
JMSF020D06+ ACATCTTTCTTCAGACTTGCAGCTTCATCTTGAATTGAATTTAAAAGATCATTGTAATCT
                      ____________________________________________________________
consensus ACATCTTTCTTCAGACTTGCAGCTTCATCTTGAATTGAATTTAAAAGATCATTGTAATCT
 
. : . : . : . : . : . :
JMFF007P18+ ATTTTTTCTTCAATAATCAACTCTGCGCTTTTGGGCTTATAAAAGATCCCGCATCCATCT
JMSF020D06+ ATTTTTTCTTCAATAATCAACTCTGCGCTTTTGGGCTTATAAAAGATCCCGCATCCATCT
                      ____________________________________________________________
consensus ATTTTTTCTTCAATAATCAACTCTGCGCTTTTGGGCTTATAAAAGATCCCGCATCCATCT
 
. : . : . : . : . : . :
JMFF007P18+ TTCTTCTGCCCACCTCTTTGAACATAGATACTTGAGTAGCCAAAACTCTCGATATTTTTT
JMSF020D06+ TTCTTCTGCCCACCTCTTTGAACATAGATACTTGAGTAGCCAAAACTCTCGATATTTTTT
                      ____________________________________________________________
consensus TTCTTCTGCCCACCTCTTTGAACATAGATACTTGAGTAGCCAAAACTCTCGATATTTTTT
 
. : . : . : . : . : . :
JMFF007P18+ TTGTAGAAGCTATCGTACTCATCCAGTTCCTGTAAACAAAGAAAATCTGATCCTAGGCCT
JMSF020D06+ TTGTAGAAGCTATCGTACTCATCCAGTTCCTGTAAACAAAGAAAATCTGATCCTAGGCCT
                      ____________________________________________________________
consensus TTGTAGAAGCTATCGTACTCATCCAGTTCCTGTAAACAAAGAAAATCTGATCCTAGGCCT
 
. : . : . : . : . : . :
JMFF007P18+ TTAAGAACAGTCAAGATTGCCTGAGATCGAGCTTTCCACTTGAGACATGGTGACGGAGAG
JMSF020D06+ TTAAGAACAGTCAAGATTGCCTGAGATCGAGCTTTCCACTTGAGACATGGTGACGGAGAG
                      ____________________________________________________________
consensus TTAAGAACAGTCAAGATTGCCTGAGATCGAGCTTTCCACTTGAGACATGGTGACGGAGAG
 
. : . : . : . : . : . :
JMFF007P18+ TGTGGAAATGAAGCACTCTTTACATAAGCCTGAGCCAAAATGTTATAAGACACAAGACTG
JMSF020D06+ TGTGGAAATGAAGCACTCTTTACATAAGCCTGAGCCAAAATGTTATAAGACACAAGACTG
                      ____________________________________________________________
consensus TGTGGAAATGAAGCACTCTTTACATAAGCCTGAGCCAAAATGTTATAAGACACAAGACTG
 
. : . : . : . : . : . :
JMFF007P18+ AATTTGAAACCTTCAGATTTGCTTATTGAAGCAATTTCACTCTTTTCAACAGGAGTGAAC
JMSF020D06+ AATTTGAAACCTTCAGATTTGCTTATTGAAGCAATTTCACTCTTTTCAACAGGAGTGAAC
                      ____________________________________________________________
consensus AATTTGAAACCTTCAGATTTGCTTATTGAAGCAATTTCACTCTTTTCAACAGGAGTGAAC
 
. : . : . : . : . : . :
JMFF007P18+ TTGGGACACAAAGGTTCAGGTGCTGTGCTCATTTTGCTCAAGCAAACCGTTCTATATCTG
JMSF020D06+ TTGGGACACAAAGGTTCAGGTGCTGTGCTCATTTTGCTCAAGCAAACCGTTCTATATCTG
                      ____________________________________________________________
consensus TTGGGACACAAAGGTTCAGGTGCTGTGCTCATTTTGCTCAAGCAAACCGTTCTATATCTG
 
. : . : . : . : . : . :
JMFF007P18+ GAAGATGGACAAGCAAGTGAGAAGCGAGGAATCAAGC
JMSF020D06+ GAAGATGGACAAGCAAGTGAGAAGCGAGGAATCAAGCAGAAGAAAGAGCTCTTCAGCACC
                      ____________________________________________________________
consensus GAAGATGGACAAGCAAGTGAGAAGCGAGGAATCAAGCAGAAGAAAGAGCTCTTCAGCACC