Previous Contig 005868:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF020A14Sequence716005868 (3)gb:AP000377_18198481e-28Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYM9.434012886 (3)gb:AX196340_14639471e-15Sequence 47 from Patent WO0151627.
JMSF033C16Sequence675005868 (3)gb:AP000377_18198486e-30Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYM9.614012886 (3)gb:AY163905_15860453e-41Glycine max receptor-like kinase RHG4 (Rhg4) mRNA, complete cds.>gb:AF506518_180
JMSF035O04Sequence668005868 (3)gb:AP000377_18198486e-26Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYM9.596012886 (3)gb:AY163905_15860459e-39Glycine max receptor-like kinase RHG4 (Rhg4) mRNA, complete cds.>gb:AF506518_180

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF033C16+ ATGACGCCGGTGATACTGGCGTTGCTCGCGAAGAAAGATCCCAAGCTTGTG
JMSF035O04+ AGCTTGTG
JMSF020A14+ TAGGNATGACGCCGGTGATACTGGCGTTGCTCGCGAAGAAAGATCCCAAGCTTGTG
                      ____________________________________________________________
consensus TAGGNATGACGCCGGTGATACTGGCGTTGCTCGCGAAGAAAGATCCCAAGCTTGTG
 
. : . : . : . : . : . :
JMSF033C16+ CTTTCGGCCAAATAACTAGAAATTTGCCATGGGCTGAGCTCGCCATTGTCGGAAATGCTG
JMSF035O04+ CTTTCGGCCAAATAACTAGAAATTTGCCATGGGCTGAGCTCGCCATTGTCGGAAATGCTG
JMSF020A14+ CTTTCGNCCAAATAACTAGAAATTTGCCATGGGCTGAGCTCGCCATNGTCGGAAATGCTG
                      ____________________________________________________________
consensus CTTTCGGCCAAATAACTAGAAATTTGCCATGGGCTGAGCTCGCCATTGTCGGAAATGCTG
 
. : . : . : . : . : . :
JMSF033C16+ AAAATCCGCAAATTGGGAAGACCCAAGAGGAAATCTGGGGGGATTGAGCTGAACTCATTG
JMSF035O04+ AAAATCCGCAAATTGGGAAGACCCAAGAGGAAATCTGGGGGGATTGAGCTGAACTCATTG
JMSF020A14+ AAAATCCGCAAATTGGGAAGACCCAAGAGGAAATCTGGGGGGATTGAGCTGAACTCATTG
                      ____________________________________________________________
consensus AAAATCCGCAAATTGGGAAGACCCAAGAGGAAATCTGGGGGGATTGAGCTGAACTCATTG
 
. : . : . : . : . : . :
JMSF033C16+ CTGTCTAAGTAGAGCTCTTCGAGGCTGGACATATTAGCGAAAGACGGCAAGGGCCCGGAG
JMSF035O04+ CTGTCTAAGTAGAGCTCTTCGAGGCTGGACATATTAGCGAAAGACGGCAAGGGCCCGGAG
JMSF020A14+ CTGTCTAAGTAGAGCTCTTCGAGGCTGGACATATTAGCGAAAGACGGCAAGGGCCCGGAG
                      ____________________________________________________________
consensus CTGTCTAAGTAGAGCTCTTCGAGGCTGGACATATTAGCGAAAGACGGCAAGGGCCCGGAG
 
. : . : . : . : . : . :
JMSF033C16+ AGGGAGTTTTTCTGGACGGAAAGTGATCGGAGAGACGCCAGCTGTGTGAGCTCAGAAGGG
JMSF035O04+ AGGGAGTTTTTCTGGACGGAAAGTGATCGGAGAGACGCCAGCTGTGTGAGCTCAGAAGGG
JMSF020A14+ AGGGAGTTTTTCTGGACGGAAAGTGATCGGAGAGACGCCAGCTGTGTGAGCTCAGAAGGG
                      ____________________________________________________________
consensus AGGGAGTTTTTCTGGACGGAAAGTGATCGGAGAGACGCCAGCTGTGTGAGCTCAGAAGGG
 
. : . : . : . : . : . :
JMSF033C16+ AGATTGCCGGAGATGGACTGGGAGTCGATGTTGATGGAGACCACATTGCCGGTGGGCTTG
JMSF035O04+ AGATTGCCGGAGATGGACTGGGAGTCGATGTTGATGGAGACCACATTGCCGGTGGGCTTG
JMSF020A14+ AGATTGCCGGAGATGGACTGGGAGTCGATGTTGATGGAGACCACATTGCCGGTGGGCTTG
                      ____________________________________________________________
consensus AGATTGCCGGAGATGGACTGGGAGTCGATGTTGATGGAGACCACATTGCCGGTGGGCTTG
 
. : . : . : . : . : . :
JMSF033C16+ TCGCAGTTGACATTAGTCCAAGTACACGGATCTTTGGAAGCGGACCAGCCAGAAGGCGCC
JMSF035O04+ TCGCAGTTGACATTAGTCCAAGTACACGGATCTTTGGAAGCGGACCAGCCAGAAGGCGCC
JMSF020A14+ TCGCAGTTGACATTAGTCCAAGTACACGGATCTTTGGAAGCGGACCAGCCAGAAGGCGCC
                      ____________________________________________________________
consensus TCGCAGTTGACATTAGTCCAAGTACACGGATCTTTGGAAGCGGACCAGCCAGAAGGCGCC
 
. : . : . : . : . : . :
JMSF033C16+ GGAGAGAGGGCAGCTAAGAGCTTGGACATGACGGCGGCGTCATCGCAAAATGAAACAGAG
JMSF035O04+ GGAGAGAGGGCAGCTAAGAGCTTGGACATGACGGCGGCGTCATCGCAAAATGAAACAGAG
JMSF020A14+ GGAGAGAGGGCAGCTAAGAGCTTGGACATGACGGCGGCGTCATCGCAAAATGAAACAGAG
                      ____________________________________________________________
consensus GGAGAGAGGGCAGCTAAGAGCTTGGACATGACGGCGGCGTCATCGCAAAATGAAACAGAG
 
. : . : . : . : . : . :
JMSF033C16+ AGCAGGCCGAGTAAGAGGAGTAAACGGAGAAAGGATGGAGCTTTCTGGGAGGACATTGCA
JMSF035O04+ AGCAGGCCGAGTAAGAGGAGTAAACGGAGAAAGGATGGAGCTTTCTGGGAGGACATTGCA
JMSF020A14+ AGCAGGCCGAGTAAGAGGAGTAAACGGAGAAAGGATGGAGCTTTCTGGGAGGACATTGCA
                      ____________________________________________________________
consensus AGCAGGCCGAGTAAGAGGAGTAAACGGAGAAAGGATGGAGCTTTCTGGGAGGACATTGCA
 
. : . : . : . : . : . :
JMSF033C16+ GGTGGGGTTTAGTTTCGTGGCGGAGGAAGCATATAAGGTTGGGTGGTACACGGCGGCGGT
JMSF035O04+ GGTGGGGTTTAGTTTCGTGGCGGAGGAAGCATATAAGGTTGGGTGGTACACGGCGGCGGT
JMSF020A14+ GGTGGGGTTTAGTTTCGTGGCGGAGGAAGCATATAAGGTTGGGTGGTACACGGCGGCGGT
                      ____________________________________________________________
consensus GGTGGGGTTTAGTTTCGTGGCGGAGGAAGCATATAAGGTTGGGTGGTACACGGCGGCGGT
 
. : . : . : . : . : . :
JMSF033C16+ GGTGGTGGTGGCGCGGTATGAATTTTGGAATTTGAAAAGACTTTTAAAAAGTTAGAGAAG
JMSF035O04+ GGTGGTGGTGGCGCGGTATGAATTTTGGAATTTGAAAAGACTTTTAAAAAGTTAGAGAAG
JMSF020A14+ GGTGGTGGTGGCGCGGTATGAATTTTGGAATTTGAAAAGACTTTTAAAAAGTTAGAGAAG
                      ____________________________________________________________
consensus GGTGGTGGTGGCGCGGTATGAATTTTGGAATTTGAAAAGACTTTTAAAAAGTTAGAGAAG
 
. : . : . : . : . : . :
JMSF033C16+ AAAAGAAAAGCGTATGTTC
JMSF035O04+ AAAAGAAAAGCGTATGTTCTGGTGGTTTATCATGTTCTTGAAGGATTTATGCTTATG
JMSF020A14+ AAAAGAAAAGCGTATGTTCTGGTGGTTTATCATGTTCTTGAAGGATTTATGCTTATGATC
                      ____________________________________________________________
consensus AAAAGAAAAGCGTATGTTCTGGTGGTTTATCATGTTCTTGAAGGATTTATGCTTATGATC