Previous Contig 005864:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036J16Sequence546005864 (4)gb:AF124842_17703228e-75Capsicum annuum squalene synthase (SS) mRNA, complete cds.723008442 (12)sp|P53800|FDFT_NICBE2e-72Farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21) (Squalene synthetase) (SQ
JMFF040O18Sequence549005864 (4)gb:AF124842_17703228e-75Capsicum annuum squalene synthase (SS) mRNA, complete cds.797008442 (12)sp|P53800|FDFT_NICBE1e-88Farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21) (Squalene synthetase) (SQ
JMSF020A01Sequence696005864 (4)gb:AF124842_17703225e-90Capsicum annuum squalene synthase (SS) mRNA, complete cds.791008442 (12)sp|P53800|FDFT_NICBE6e-82Farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21) (Squalene synthetase) (SQ
JMSF036N16Sequence609005864 (4)gb:AF124842_17703224e-91Capsicum annuum squalene synthase (SS) mRNA, complete cds.595012854 (4)sp|Q9M4W3|ISPF_CATRO4e-722-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplast precursor (EC

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF036N16+ TAATCCAACAAGCCCAGCAACATAATGACAATATTCATCATAATCA
JMSF020A01+ AAGCCCAGCAACATAATGACAATATTCATCATAATCA
                      ____________________________________________________________
consensus TAATCCAACAAGCCCAGCAACATAATGACAATATTCATCATAATCA
 
. : . : . : . : . : . :
JMSF036N16+ TCAATTGTTTCGACCTCCTTGCATATAAACTTTGCCAT-CCCTGCACCCATCCTCATGGT
JMFF036J16+ TTGCATATAAACTTTGCCATCCCCTGCACCCATCCTCATGGT
JMFF040O18+ TCCTTGCATATAAACTTTGCCATCCCCTGCACCCATCCTCATGGT
JMSF020A01+ TCAATTGTTTCGACCTCCTTGCATATAAACTTTGCCAT-CCCTGCACCCATCCTCATGGT
                      ____________________________________________________________
consensus TCAATTGTTTCGACCTCCTTGCATATAAACTTTGCCATCCCCTGCACCCATCCTCATGGT
 
. : . : . : . : . : . :
JMSF036N16+ AATATCCTCAATTGCTTCCTGATAATTTTTCCCAAGTTCCAGAAAAGCAGTAGAAACATG
JMFF036J16+ AATATCCTCAATTGCTTCCTGATAATTTTTCCCAAGTTCCAGAAAAGCAGTAGAAACATG
JMFF040O18+ AATATCCTCAATTGCTTCCTGATAATTTTTCCCAAGTTCCAGAAAAGCAGTAGAAACATG
JMSF020A01+ AATATCCTCAATTGCTTCCTGATAATTTTTCCCAAGTTCCAGAAAAGCAGTAGAAACATG
                      ____________________________________________________________
consensus AATATCCTCAATTGCTTCCTGATAATTTTTCCCAAGTTCCAGAAAAGCAGTAGAAACATG
 
. : . : . : . : . : . :
JMSF036N16+ ATGGAACTGGTCCATGAGAACTTTATAGTCCTTTGTTCCACACAGGAAATGCCATTCACG
JMFF036J16+ ATGGAACTGGTCCATGAGAACTTTATAGTCCTTTGTTCCACACAGGAAATGCCATTCACG
JMFF040O18+ ATGGAACTGGTCCATGAGAACTTTATAGTCCTTTGTTCCACACAGGAAATGCCATTCACG
JMSF020A01+ ATGGAACTGGTCCATGAGAACTTTATAGTCCTTTGTTCCACACAGGAAATGCCATTCACG
                      ____________________________________________________________
consensus ATGGAACTGGTCCATGAGAACTTTATAGTCCTTTGTTCCACACAGGAAATGCCATTCACG
 
. : . : . : . : . : . :
JMSF036N16+ GTCATATATGTGACGATGAAAATCTATCAGAATAGGTACTTTAACTTCTGTGGCTATGCT
JMFF036J16+ GTCATATATGTGACGATGAAAATCTATCAGAATAGGTACTTTAACTTCTGTGGCTATGCT
JMFF040O18+ GTCATATATGTGACGATGAAAATCTATCAGAATAGGTACTTTAACTTCTGTGGCTATGCT
JMSF020A01+ GTCATATATGTGACGATGAAAATCTATCAGAATAGGTACTTTAACTTCTGTGGCTATGCT
                      ____________________________________________________________
consensus GTCATATATGTGACGATGAAAATCTATCAGAATAGGTACTTTAACTTCTGTGGCTATGCT
 
. : . : . : . : . : . :
JMSF036N16+ TGTATCATCCTCAACAGTGTCAAGTGCTCGAAGAACCAAATAGAAAATACACACGGCGTC
JMFF036J16+ TGTATCATCCTCAACAGTGTCAAGTGCTCGAAGAACCAAATAGAAAATACACACGGCGTC
JMFF040O18+ TGTATCATCCTCAACAGTGTCAAGTGCTCGAAGAACCAAATAGAAAATACACACGGCGTC
JMSF020A01+ TGTATCATCCTCAACAGTGTCAAGTGCTCGAAGAACCAAATAGAAAATACACACGGCGTC
                      ____________________________________________________________
consensus TGTATCATCCTCAACAGTGTCAAGTGCTCGAAGAACCAAATAGAAAATACACACGGCGTC
 
. : . : . : . : . : . :
JMSF036N16+ GCGAAGCTCGATAGGGAGCTGCTGGATAACGAGAGCGAAGCTTCGAGAGACCTTCTGGAG
JMFF036J16+ GCGAAGCTCGATAGGGAGCTGCTGGATAACGAGAGCGAAGCTTCGAGAGACCTTCTGGAG
JMFF040O18+ GCGAAGCTCGATAGGGAGCTGCTGGATAACGAGAGCGAAGCTTCGAGAGACCTTCTGGAG
JMSF020A01+ GCGAAGCTCGATAGGGAGCTGCTGGATAACGAGAGCGAAGCTTCGAGAGACCTTCTGGAG
                      ____________________________________________________________
consensus GCGAAGCTCGATAGGGAGCTGCTGGATAACGAGAGCGAAGCTTCGAGAGACCTTCTGGAG
 
. : . : . : . : . : . :
JMSF036N16+ CATGGTGTAGCAGAATCCCCAGTGAGGCTGCGGCGGGATCTGNTTCTCGATCTGCCTCGC
JMFF036J16+ CATGGTGTAGCAGAATCCCCAGTGAGGCTGCGGCGGGATCTGCTTCTCGATCTGCCTCGC
JMFF040O18+ CATGGTGTAGCAGAATCCCCAGTGAGGCTGCGGCGGGATCTGCTTCTCGATCTGCCTCGC
JMSF020A01+ CATGGTGTAGCAGAATCCCCAGTGAGGCTGCGGCGGGATCTGCTTCTCGATCTGCCTCGC
                      ____________________________________________________________
consensus CATGGTGTAGCAGAATCCCCAGTGAGGCTGCGGCGGGATCTGCTTCTCGATCTGCCTCGC
 
. : . : . : . : . : . :
JMSF036N16+ CGCAATCTTCAGCTTAATCAGCGGGTACACGTCGTCCGGATGCTTCAACATCGCTCCCAA
JMFF036J16+ CGCAATCTTCAGCTTAATCAGCGGGTACACGTCGTCCGGATGCTTCAACATCGCTCCCAA
JMFF040O18+ CGCAATCTTCAGCTTAATCAGCGGGTACACGTCGTCCGGATGCTTCAACATCGCTCCCAA
JMSF020A01+ CGCAATCTTCAGCTTAATCAGCGGGTACACGTCGTCCGGATGCTTCAACATCGCTCCCAA
                      ____________________________________________________________
consensus CGCAATCTTCAGCTTAATCAGCGGGTACACGTCGTCCGGATGCTTCAACATCGCTCCCAA
 
. : . : . : . : . : . :
JMSF036N16+ ACTCCCCATTTTTCACACTATTTCAGTATTCCTAACCAGTACACAGTTTCCAATCTATCA
JMFF036J16+ ACTCCCCATTTTTCACACTATTTCAGTATTCCTAACCAGTACACAGTTTCCAATCTATCA
JMFF040O18+ ACTCCCCATTTTTCACACTATTTCAGTATTCCTAACCAGTACACAGTTTCCAATCTATCA
JMSF020A01+ ACTCCCCATTTTTCACACTATTTCAGTATTCCTAACCAGTACACAGTTTCCAATCTATCA
                      ____________________________________________________________
consensus ACTCCCCATTTTTCACACTATTTCAGTATTCCTAACCAGTACACAGTTTCCAATCTATCA
 
. : . : . : . : . : . :
JMSF036N16+ CCGATCCAATTTAAAGATCCTTT
JMFF036J16+ CCGATCCAATTTAAAGATCCTTT
JMFF040O18+ CCGATCCAATTTAAAGATCCTTT
JMSF020A01+ CCGATCCAATTTAAAGATCCTTTCGAAGCGTACATTCATACAACAGAGAGAGATATAGAG
                      ____________________________________________________________
consensus CCGATCCAATTTAAAGATCCTTTCGAAGCGTACATTCATACAACAGAGAGAGATATAGAG
 
. : . : . : . : . : . :
JMSF020A01+ AGTTTCGAAATTCTGGATGTACCTGTGTGTGTTCTGTAATGCAAAGCCTGTGAGCTTTTC
                      ____________________________________________________________
consensus AGTTTCGAAATTCTGGATGTACCTGTGTGTGTTCTGTAATGCAAAGCCTGTGAGCTTTTC