Previous Contig 005852:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN034L14Sequence604005852 (4)sp|P46637|ARG1_ARATH2e-92Arginase (EC 3.5.3.1).>pir|F85089|F85089 arginase [imported] - Arabidopsis thali
JMSF006P14Sequence253005852 (4)gb:AY656837_16202888e-19Lycopersicon esculentum arginase 1 (ARG1) mRNA, complete cds.
JMSF019O02Sequence406005852 (4)gb:AY656837_16202884e-43Lycopersicon esculentum arginase 1 (ARG1) mRNA, complete cds.787005852 (4)sp|P46637|ARG1_ARATHe-106Arginase (EC 3.5.3.1).>pir|F85089|F85089 arginase [imported] - Arabidopsis thali

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF019O02- ACAGCCCTTATTCACCAAACTCAGATAATTCCTACCTCAG
                      ____________________________________________________________
consensus ACAGCCCTTATTCACCAAACTCAGATAATTCCTACCTCAG
 
. : . : . : . : . : . :
rJMSF019O02- ACTCATAGGACCATCCTTATTCACTACTACTTGCTGGTGAACGCCTTTCAGTGGGTTACT
                      ____________________________________________________________
consensus ACTCATAGGACCATCCTTATTCACTACTACTTGCTGGTGAACGCCTTTCAGTGGGTTACT
 
. : . : . : . : . : . :
rJMSF019O02- TGGACATCTTAGCAGCCAGCTCTCTTGCTAGTTTTGCAGCCACCATTGCAGTCATCCCAT
                      ____________________________________________________________
consensus TGGACATCTTAGCAGCCAGCTCTCTTGCTAGTTTTGCAGCCACCATTGCAGTCATCCCAT
 
. : . : . : . : . : . :
rJMSF019O02- GAACAGTATCCCGCTGCGAGTTGTACTCAACCACATCGGCTGCCACGAGGTTGCCTTTAA
                      ____________________________________________________________
consensus GAACAGTATCCCGCTGCGAGTTGTACTCAACCACATCGGCTGCCACGAGGTTGCCTTTAA
 
. : . : . : . : . : . :
rJMSF019O02- GGTTGTGGATTATGTTGAGGACGTCCCGGAAAGAGAGACCTCCCGGCTCTAAGTGTGACA
                      ____________________________________________________________
consensus GGTTGTGGATTATGTTGAGGACGTCCCGGAAAGAGAGACCTCCCGGCTCTAAGTGTGACA
 
. : . : . : . : . : . :
rJMSF019O02- CTCCGCTAGCAAATGCAGGATCCAGAACGTCCACATCCACCGAAATGTACACTCCCTTCA
                      ____________________________________________________________
consensus CTCCGCTAGCAAATGCAGGATCCAGAACGTCCACATCCACCGAAATGTACACTCCCTTCA
 
. : . : . : . : . : . :
rJMSF019O02- CCCCCTCCCCGAGTTTCAGATTTTCTAGAAATTCGCGGTCTTTGGAAAATGTTCGCATTT
JMFN034L14+ CAGATTTTCTAGAAATTCGCGGTCTTTGGAAAATGTTCGCATTT
                      ____________________________________________________________
consensus CCCCCTCCCCGAGTTTCAGATTTTCTAGAAATTCGCGGTCTTTGGAAAATGTTCGCATTT
 
. : . : . : . : . : . :
rJMSF019O02- CAAATTGCTCCACACCGAACTTTTGTCCTTGTTCGCGGCCTTCTATGTTGATTGATCTAA
JMFN034L14+ CAAATTGCTCCACACCGAACTTTTGTCCTTGTTCGCGGCCTTCTATGTTGATTGATCTAA
                      ____________________________________________________________
consensus CAAATTGCTCCACACCGAACTTTTGTCCTTGTTCGCGGCCTTCTATGTTGATTGATCTAA
 
. : . : . : . : . : . :
rJMSF019O02- GTCCGACTTGCAGGAGTCGCCTGGCATAGCCACCTTCCATGATTCGAGCAAAGCTAGATG
JMFN034L14+ GTCCGACTTGCAGGAGTCGCCTGGCATAGCCACCTTCCATGATTCGAGCAAAGCTAGATG
                      ____________________________________________________________
consensus GTCCGACTTGCAGGAGTCGCCTGGCATAGCCACCTTCCATGATTCGAGCAAAGCTAGATG
 
. : . : . : . : . : . :
rJMSF019O02- CGTGAGAGTACTTGTTTCCTTCAAACTCATCGTAGAGGTCAGGGTGAGCATCAAGGTGAA
JMFN034L14+ CGTGAGAGTACTTGTTTCCTTCAAACTCATCGTAGAGGTCAGGGTGAGCATCAAGGTGAA
                      ____________________________________________________________
consensus CGTGAGAGTACTTGTTTCCTTCAAACTCATCGTAGAGGTCAGGGTGAGCATCAAGGTGAA
 
. : . : . : . : . : . :
rJMSF019O02- GGATATCCACTTGTCCTCCAAGCTTCTCCGACACAGCTTTCACCACAGGATATGATATGG
JMFN034L14+ GGATATCCACTTGTCCTCCAAGCTTCTCCGACACAGCTTTCACCACAGGATATGATATGG
                      ____________________________________________________________
consensus GGATATCCACTTGTCCTCCAAGCTTCTCCGACACAGCTTTCACCACAGGATATGATATGG
 
. : . : . : . : . : . :
rJMSF019O02- AGTGATCACCCCCCAACACCAAGGGCCGCATTACACCCTCATTCATCACCGTCTTCACAG
JMFN034L14+ AGTGATCACCCCCCAACACCAAGGGCCGCATTACACCCTCATTCATCACCGTCTTCACAG
                      ____________________________________________________________
consensus AGTGATCACCCCCCAACACCAAGGGCCGCATTACACCCTCATTCATCACCGTCTTCACAG
 
. : . : . : . : . : . :
rJMSF019O02- ATTCACCGATGATATTAAATAATCCATCATCATCTACGCCACAATCACGTAAATCTTGTA
JMFN034L14+ ATTCACCGATGATATTAAATAATCCATCATCATCTACGCCACAATCACGTAAATCTTGTA
                      ____________________________________________________________
consensus ATTCACCGATGATATTAAATAATCCATCATCATCTACGCCACAATCACGTAAATCTTGTA
 
. : . : . : . : . : . :
rJMSF019O02- TTGGGACATCACCAATATCAGTCAAGA
JMFN034L14+ TTGGGACATCACCAATATCAGTCAAGACGCGTGGGTCTTTTATGTCTTTGCCTTCTTCAG
JMSF019O02+ ATATCAGTCAAGACGCGTGGGTCTTTTATGTCTTTGCCTTCTTCAG
                      ____________________________________________________________
consensus TTGGGACATCACCAATATCAGTCAAGACGCGTGGGTCTTTTATGTCTTTGCCTTCTTCAG
 
. : . : . : . : . : . :
JMFN034L14+ TTGTAGAGTTTGTGCTGCCACACCACATGGCCTCTCGAATGTAAGGAGGGGCAAATGCTG
JMSF019O02+ TTGTAGAGTTTGTGCTGCCACACCACATGGCCTCTCGAATGTAAGGAGGGGCAAATGCTG
                      ____________________________________________________________
consensus TTGTAGAGTTTGTGCTGCCACACCACATGGCCTCTCGAATGTAAGGAGGGGCAAATGCTG
 
. : . : . : . : . : . :
JMFN034L14+ GGCCCTGGAGAAATGAGGAGTTATGCCCCAGAGGAACTCCAAGAAGACATGATGATGCCA
JMSF006P14+ AGAAGAGATGATGATGCTA
JMSF019O02+ GGCCCTGGAGAAATGAGGAGTTATGCCCCAGAGGAACTCCAAGAAGACATGATGATGCCA
                      ____________________________________________________________
consensus GGCCCTGGAGAAATGAGGAGTTATGCCCCAGAGGAACTCCAAGAAGACATGATGATGCCA
 
. : . : . : . : . : . :
JMSF006P14+ CAACACCCCCAAGAGCACGGAGAAGTTCTCCCTTTAGCTTAGCCCTCTCCTGGATAAGTG
JMSF019O02+ CGACACCCCCTAGAGAACGAAGAAGCTCTCCCTTTAGCTTAGCTCTCTCCCGAATAAGTG
                      ____________________________________________________________
consensus CGACACCCCCTAGAGCACGGAGAAGTTCTCCCTTTAGCTTAGCTCTCTCCTGGATAAGTG
 
. : . : . : . : . : . :
JMSF006P14+ TAAGAGATGCCTCAATAACACGTTTTTGCCCCTTCTCTATCAAGTCTCTTGGTATATTTT
JMSF019O02+ AAAGAGATGCGTCAATAATACGTTTTTGCGCCTTGTCTCTTACGTCTTTGGGTATATGTT
                      ____________________________________________________________
consensus TAAGAGATGCGTCAATAATACGTTTTTGCGCCTTGTCTCTTACGTCTTTTGGTATATTTT
 
. : . : . : . : . : . :
JMSF006P14+ CAGCATTCAATTTGTGCAAATAATGGAATCCCATTCTTCTGATGTTGTTCATGTTTGCAA
JMSF019O02+ CACAATTCAATTTGTGCAAATAATGCATACCCATTCTTCTGATATTATTCATATTTGCAA
                      ____________________________________________________________
consensus CAGCATTCAATTTGTGCAAATAATGGATTCCCATTCTTCTGATGTTGTTCATGTTTGCAA
 
. : . : . : . : . : . :
JMSF006P14+ A
JMSF019O02+ ATCCACTAGTGAACACGAAGGACTGAGAAGAAGCAGGAGACTCACAAAGCTTGTCTTTTC
                      ____________________________________________________________
consensus ATCCACTAGTGAACACGAAGGACTGAGAAGAAGCAGGAGACTCACAAAGCTTGTCTTTTC