Previous Contig 005850:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003D04Sequence571005850 (2)704012106 (3)
JMSF019N07Sequence495005850 (2)791012106 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF003D04+ TTCTATATGCCGCTGTCAATGTAGCATCATAAATTCAGCTAG
                      ____________________________________________________________
consensus TTCTATATGCCGCTGTCAATGTAGCATCATAAATTCAGCTAG
 
. : . : . : . : . : . :
JMFF003D04+ GCCACCATTTCCTGACCCTTTTCGCTAACAACTTGTATTTCATCAGAATCATCATCCCGT
                      ____________________________________________________________
consensus GCCACCATTTCCTGACCCTTTTCGCTAACAACTTGTATTTCATCAGAATCATCATCCCGT
 
. : . : . : . : . : . :
JMFF003D04+ TCATCATTATTATCTATAGTAACCGGCTTATCTGGATCTCCCTCCAATACCACACAATCA
JMSF019N07+ AATACCACACAATCA
                      ____________________________________________________________
consensus TCATCATTATTATCTATAGTAACCGGCTTATCTGGATCTCCCTCCAATACCACACAATCA
 
. : . : . : . : . : . :
JMFF003D04+ CCGTCATCATCGTCCACAGCTTTCGCCGAATCTTTAGAGACTGTACTCGAGGACTTTACA
JMSF019N07+ CCGTCATCATCGTCCACAGCTTTCGCCGAGTCTTTAGAGACTGTACTCGAGGACTTTACA
                      ____________________________________________________________
consensus CCGTCATCATCGTCCACAGCTTTCGCCGAGTCTTTAGAGACTGTACTCGAGGACTTTACA
 
. : . : . : . : . : . :
JMFF003D04+ GTCTGCCTGGAGTTCAAAATAACCTCGCCCACCACGACCACATCATCGGAATCATCGGAA
JMSF019N07+ GTCTGCCTGGAGTTCAAAATAACCTCGCCCACCACGACCACATCATCGGAATCATCGGAA
                      ____________________________________________________________
consensus GTCTGCCTGGAGTTCAAAATAACCTCGCCCACCACGACCACATCATCGGAATCATCGGAA
 
. : . : . : . : . : . :
JMFF003D04+ GGTTCCTTGTCGTCGTCGAGAAGTCCCGCTAGCCAGTCATAGTCATCCCCGCCTCCTCCA
JMSF019N07+ GGTTCCTTGTCGTCGTCGAGAAGTCCCGCTAGCCAGTCATAGTCATCCCCGCCTCCTCCA
                      ____________________________________________________________
consensus GGTTCCTTGTCGTCGTCGAGAAGTCCCGCTAGCCAGTCATAGTCATCCCCGCCTCCTCCA
 
. : . : . : . : . : . :
JMFF003D04+ TCAGCGCCGACACCGCTCCTCTCGCCGGTAGCCTCTTCCTCGTCCGAACTTATGTCGTGT
JMSF019N07+ TCAGCGCCGACACCGCTCCTCTCGCCGGTAGCCTCTTCCTCGTCCGAACTTATGTCGTGT
                      ____________________________________________________________
consensus TCAGCGCCGACACCGCTCCTCTCGCCGGTAGCCTCTTCCTCGTCCGAACTTATGTCGTGT
 
. : . : . : . : . : . :
JMFF003D04+ ATAACTGCTTTAGGACCATCCATCAGAGTACAGGAGCAGGGTTCTTCATGAATTTCGCCG
JMSF019N07+ ATAACTGCTTTAGGACCATCCATCAGAGTACAGGAGCAGGGTTCTTCATGAATTTCGCCG
                      ____________________________________________________________
consensus ATAACTGCTTTAGGACCATCCATCAGAGTACAGGAGCAGGGTTCTTCATGAATTTCGCCG
 
. : . : . : . : . : . :
JMFF003D04+ TCAGACCGTTCAAAGCTTTCATTTATTCTCCCGCGCACGTAATCTAGGGCAAAATTGGGT
JMSF019N07+ TCAGACCGTTCAAAGCTTTCATTTATTCTCCCGCGCACGTAATCTAGGGCAAAATTGGGT
                      ____________________________________________________________
consensus TCAGACCGTTCAAAGCTTTCATTTATTCTCCCGCGCACGTAATCTAGGGCAAAATTGGGT
 
. : . : . : . : . : . :
JMFF003D04+ TTCCCGATTGATTGGGAAACTTAATAAACCCTAGCTTTTCAAAACTGGA
JMSF019N07+ TTCCCGATTGATTGGGAAACTTAATAAACCCTAGCTTTTCAAAACTGGACAGATGAAAAT
                      ____________________________________________________________
consensus TTCCCGATTGATTGGGAAACTTAATAAACCCTAGCTTTTCAAAACTGGACAGATGAAAAT
 
. : . : . : . : . : . :
JMSF019N07+ GAGATTAGATTCGTCGTTTTGAAAGGGGAAAGGAAAGGGCTTCGAAATTGCACTCTTGCC
                      ____________________________________________________________
consensus GAGATTAGATTCGTCGTTTTGAAAGGGGAAAGGAAAGGGCTTCGAAATTGCACTCTTGCC