Previous Contig 005848:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN009M22Sequence577005848 (7)sp|Q9FY84|PEN2_ARATH5e-40Gamma-secretase subunit PEN2-like protein.>gb:ATT5E8_1556126 Arabidopsis thalian
JMFN015J03Sequence546005848 (7)sp|Q9FY84|PEN2_ARATH5e-40Gamma-secretase subunit PEN2-like protein.>gb:ATT5E8_1556126 Arabidopsis thalian
JMFN033A24Sequence566005848 (7)sp|Q9FY84|PEN2_ARATH6e-39Gamma-secretase subunit PEN2-like protein.>gb:ATT5E8_1556126 Arabidopsis thalian
JMFN034D05Sequence609005848 (7)sp|Q9FY84|PEN2_ARATH6e-40Gamma-secretase subunit PEN2-like protein.>gb:ATT5E8_1556126 Arabidopsis thalian
JMFN034F03Sequence590005848 (7)sp|Q9FY84|PEN2_ARATH6e-40Gamma-secretase subunit PEN2-like protein.>gb:ATT5E8_1556126 Arabidopsis thalian
JMSF019M04Sequence529005848 (7)sp|Q9FY84|PEN2_ARATH4e-40Gamma-secretase subunit PEN2-like protein.>gb:ATT5E8_1556126 Arabidopsis thalian595005848 (7)sp|Q9FY84|PEN2_ARATH6e-40Gamma-secretase subunit PEN2-like protein.>gb:ATT5E8_1556126 Arabidopsis thalian

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN033A24+ GAATTCATCTGAAGCTTAAACAAAAACTGAGG
JMFN015J03+ GAAGCTTAAACAAAAACTGAGG
JMFN009M22+ AATGAGAATTCATCTGAAGCTTAAACAAAAACTGAGG
JMFN034F03+ GAGG
JMFN034D05+ GAAGCTTAAACAAAAACTGAGG
                      ____________________________________________________________
consensus AATGAGAATTCATCTGAAGCTTAAACAAAAACTGAGG
 
. : . : . : . : . : . :
JMFN033A24+ CAAGTGGGTAGGGATCATGATTCATGAATACAGCCGATGAACACAATTTTCCCATGTTGA
JMFN015J03+ CAAGTGGGTAGGGATCATGATTCATGAATACAGCCGATGAACACAATTTTCCCATGTTGA
JMFN009M22+ CAAGTGGGTAGGGATCATGATTCATGAATACAGCCGATGAACACAATTTTCCCATGTTGA
JMFN034F03+ CAAGTGGGTAGGGATCATGATTCATGAATACAGCCGATGAACACAATTTTCCCATGTTGA
JMFN034D05+ CAAGTGGGTAGGGATCATGATTCATGAATACAGCCGATGAACACAATTTTCCCATGTTGA
rJMSF019M04- GGGTAGGGATCATGATTCATGAATACAGCCGATGAACACAATTTTCCCATGTTGA
                      ____________________________________________________________
consensus CAAGTGGGTAGGGATCATGATTCATGAATACAGCCGATGAACACAATTTTCCCATGTTGA
 
. : . : . : . : . : . :
JMFN033A24+ AAAAAGCAAAATTAAGCAGATGCCAAAACAACTAAACAGTTATAGTCTCGATCTGGGAAA
JMFN015J03+ AAAAAGCAAAATTAAGCAGATGCCAAAACAACTAAACAGTTATAGTCTCGATCTGGGAAA
JMFN009M22+ AAAAAGCAAAATTAAGCAGATGCCAAAACAACTAAACAGTTATAGTCTCGATCTGGGAAA
JMFN034F03+ AAAAAGCAAAATTAAGCAGATGCCAAAACAACTAAACAGTTATAGTCTCGATCTGGGAAA
JMFN034D05+ AAAAAGCAAAATTAAGCAGATGCCAAAACAACTAAACAGTTATAGTCTCGATCTGGGAAA
rJMSF019M04- AAAAAGCAAAATTAAGCAGATGCCAAAACAACTAAACAGTTATAGTCTCGATCTGGGAAA
JMSF019M04+ TTAAGCAGATGCCAAAACAACTAAACAGTTATAGTCTCGATCTGGGAAA
                      ____________________________________________________________
consensus AAAAAGCAAAATTAAGCAGATGCCAAAACAACTAAACAGTTATAGTCTCGATCTGGGAAA
 
. : . : . : . : . : . :
JMFN033A24+ GTAAGCGAGACTCCAATCACGTAGTTTAGACGCAAGTGCAGTATTTACATCCAGCCCGTC
JMFN015J03+ GTAAGCGAGACTCCAATCACGTAGTTTAGACGCAAGTGCAGTATTTACATCCAGCCCGTC
JMFN009M22+ GTAAGCGAGACTCCAATCACGTAGTTTAGACGCAAGTGCAGTATTTACATCCAGCCCGTC
JMFN034F03+ GTAAGCGAGACTCCAATCACGTAGTTTAGACGCAAGTGCAGTATTTACATCCAGCCCGTC
JMFN034D05+ GTAAGCGAGACTCCAATCACGTAGTTTAGACGCAAGTGCAGTATTTACATCCAGCCCGTC
rJMSF019M04- GTAAGCGAGACTCCAATCACGTAGTTTAGACGCAAGTGCAGTATTTACATCCAGCCCGTC
JMSF019M04+ GTAAGCGAGACTCCAATCACGTAGTTTAGACGCAAGTGCAGTATTTACATCCAGCCCGTC
                      ____________________________________________________________
consensus GTAAGCGAGACTCCAATCACGTAGTTTAGACGCAAGTGCAGTATTTACATCCAGCCCGTC
 
. : . : . : . : . : . :
JMFN033A24+ AATCCATATTTTTCAGCGACATTGTACATTACCAGCTCATTCCAAACATTCCCGAATAGA
JMFN015J03+ AATCCATATTTTTCAGCGACATTGTACATTACCAGCTCATTCCAAACATTCCCGAATAGA
JMFN009M22+ AATCCATATTTTTCAGCGACATTGTACATTACCAGCTCATTCCAAACATTCCCGAATAGA
JMFN034F03+ AATCCATATTTTTCAGCGACATTGTACATTACCAGCTCATTCCAAACATTCCCGAATAGA
JMFN034D05+ AATCCATATTTTTCAGCGACATTGTACATTACCAGCTCATTCCAAACATTCCCGAATAGA
rJMSF019M04- AATCCATATTTTTCAGCGACATTGTACATTACCAGCTCATTCCAAACATTCCCGAATAGA
JMSF019M04+ AATCCATATTTTTCAGCGACATTGTACATTACCAGCTCATTCCAAACATTCCCGAATAGA
                      ____________________________________________________________
consensus AATCCATATTTTTCAGCGACATTGTACATTACCAGCTCATTCCAAACATTCCCGAATAGA
 
. : . : . : . : . : . :
JMFN033A24+ TGCTCTCCTCCGACAGCAAAGGTAATAGCCCATGAACCAAGAATAGCGGTGAACACTGTG
JMFN015J03+ TGCTCTCCTCCGACAGCAAAGGTAATAGCCCATGAACCAAGAATAGCGGTGAACACTGTG
JMFN009M22+ TGCTCTCCTCCGACAGCAAAGGTAATAGCCCATGAACCAAGAATAGCGGTGAACACTGTG
JMFN034F03+ TGCTCTCCTCCGACAGCAAAGGTAATAGCCCATGAACCAAGAATAGCGGTGAACACTGTG
JMFN034D05+ TGCTCTCCTCCGACAGCAAAGGTAATAGCCCATGAACCAAGAATAGCGGTGAACACTGTG
rJMSF019M04- TGCTCTCCTCCGACAGCAAAGGTAATAGCCCATGAACCAAGAATAGCGGTGAACACTGTG
JMSF019M04+ TGCTCTCCTCCGACAGCAAAGGTAATAGCCCATGAACCAAGAATAGCGGTGAACACTGTG
                      ____________________________________________________________
consensus TGCTCTCCTCCGACAGCAAAGGTAATAGCCCATGAACCAAGAATAGCGGTGAACACTGTG
 
. : . : . : . : . : . :
JMFN033A24+ AATCCGATAGCTGATCCAACTACATAGCGACGGAGATCTCGATTGAAGTGAGAAGTGGGG
JMFN015J03+ AATCCGATAGCTGATCCAACTACATAGCGACGGAGATCTGGATTGAAGTGAGAAGTGGGG
JMFN009M22+ AATCCGATAGCTGATCCAACTACATAGCGACGGAGATCTGGATTGAAGTGAGAAGTGGGG
JMFN034F03+ AATCCGATAGCTGATCCAACTACATAGCGACGGAGATCTGGATTGAAGTGAGAAGTGGGG
JMFN034D05+ AATCCGATAGCTGATCCAACTACATAGCGACGGAGATCTGGATTGAAGTGAGAAGTGGGG
rJMSF019M04- AATCCGATAGCTGATCCAACTACATAGCGACGGAGATCTGGATTGAAGTGAGAAGTGGGG
JMSF019M04+ AATCCGATAGCTGATCCAACTACATAGCGACGGAGATCTGGATTGAAGTGAGAAGTGGGG
                      ____________________________________________________________
consensus AATCCGATAGCTGATCCAACTACATAGCGACGGAGATCTGGATTGAAGTGAGAAGTGGGG
 
. : . : . : . : . : . :
JMFN033A24+ CGGCGAAGGACAGGCCAGAAGTAGAAGCAATTGACGGCCCAAAGCCATGGGAGTAGCAAA
JMFN015J03+ CGGCGAAGGACAGGCCAGAAGTAGAAGCAATTGACGGCCCAAAGCCATGGGAGTAGCAAA
JMFN009M22+ CGGCGAAGGACAGGCCAGAAGTAGAAGCAATTGACGGCCCAAAGCCATGGGAGTAGCAAA
JMFN034F03+ CGGCGAAGGACAGGCCAGAAGTAGAAGCAATTGACGGCCCAAAGCCATGGGAGTAGCAAA
JMFN034D05+ CGGCGAAGGACAGGCCAGAAGTAGAAGCAATTGACGGCCCAAAGCCATGGGAGTAGCAAA
rJMSF019M04- CGGCGAAGGACAGGCCAGAAGTAGAAGCAATTGACGGCCCAAAGCCATGGGAGTAGCAAA
JMSF019M04+ CGGCGAAGGACAGGCCAGAAGTAGAAGCAATTGACGGCCCAAAGCCATGGGAGTAGCAAA
                      ____________________________________________________________
consensus CGGCGAAGGACAGGCCAGAAGTAGAAGCAATTGACGGCCCAAAGCCATGGGAGTAGCAAA
 
. : . : . : . : . : . :
JMFN033A24+ AATCCGAACTTGAAGAACCTACGGGCGTATCCAATTGAGTCCTGCTCCGACAGCCCCAGC
JMFN015J03+ AATCCGAACTTGAAGAACCTACGGGCGTATCCAATTGAGTCCTGCTCCGACAGCCCCAGC
JMFN009M22+ AATCCGAACTTGAAGAACCTACGGGCGTATCCAATTGAGTCCTGCTCCGACAGCCCCAGC
JMFN034F03+ AATCCGAACTTGAAGAACCTACGGGCGTATCCAATTGAGTCCTGCTCCGACAGCCCCAGC
JMFN034D05+ AATCCGAACTTGAAGAACCTACGGGCGTATCCAATTGAGTCCTGCTCCGACAGCCCCAGC
rJMSF019M04- AATCCGAACTTGAAGAACCTACGGGCGTATCCAATTGAGTCCTGCTCCGACAGCCCCAGC
JMSF019M04+ AATCCGAACTTGAAGAACCTACGGGCGTATCCAATTGAGTCCTGCTCCGACAGCCCCAGC
                      ____________________________________________________________
consensus AATCCGAACTTGAAGAACCTACGGGCGTATCCAATTGAGTCCTGCTCCGACAGCCCCAGC
 
. : . : . : . : . : . :
JMFN033A24+ GGGCCGTCAACGGTAGGCCAGTCGACTCTCAGCGGAGACCCGCGGTGGCTGCCG
JMFN015J03+ GGGCCGTCAACGGTAGGCCAGTCGACTCTCAGCGGAGACCCGCG
JMFN009M22+ GGGCCGTCAACGGTAGGCCAGTCGACTCTCAGCGGAGACCCGCGGTGGCTGCCGGAGGAG
JMFN034F03+ GGGCCGTCAACGGTAGGCCAGTCGACTCTCAGCGGAGACCCGCGGTGGCTGCCGGAGGAG
JMFN034D05+ GGGCCGTCAACGGTAGGCCAGTCGACTCTCAGCGGAGACCCGCGGTGGCTGCCGGAGGAG
rJMSF019M04- GGGCCGTCAACGGTAGGCCAGTCGACTCTCAGCGGAGACCCGCGGTGGCTGCCGGAGGAG
JMSF019M04+ GGGCCGTCAACGGTAGGCCAGTCGACTCTCAGCGGAGACCCGCGGTGGCTGCCGGAGGAG
                      ____________________________________________________________
consensus GGGCCGTCAACGGTAGGCCAGTCGACTCTCAGCGGAGACCCGCGGTGGCTGCCGGAGGAG
 
. : . : . : . : . : . :
JMFN034F03+ TCGCCAGCGGTGGTGGCGCTAGAAACAGTATGATCCTGGGTTTCCA
JMFN034D05+ TCGCCAGCGGTGGTGGCGCTAGAAACAGTATGATCCTGGGTTTCCA
rJMSF019M04- TCGCCAGCGGTGGTGGCGCTAGAAACAGTATGATCCTGGGTTTCCATCCTCTGTGGGCTC
JMSF019M04+ TCGCCAGCGGTGGTGGCGCTAGAAACAGTATGATCCTGGGTTTCCATCCTCTGTGGGCTC
                      ____________________________________________________________
consensus TCGCCAGCGGTGGTGGCGCTAGAAACAGTATGATCCTGGGTTTCCATCCTCTGTGGGCTC