Previous Contig 005847:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS029D10Sequence607005847 (2)
JMSF019M01Sequence238005847 (2)746022887gb:ATAC009325_15428992e-11Arabidopsis thaliana chromosome III BAC F4P13 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS029D10+ GATTCATCTTCTTTTACAGAATTATCTTCATCACTCCNCCGTCTCTCC
                      ____________________________________________________________
consensus GATTCATCTTCTTTTACAGAATTATCTTCATCACTCCNCCGTCTCTCC
 
. : . : . : . : . : . :
JMFS029D10+ AAATTCTCATTAGAAGACTCATCTTCTTTTTCCGAATTATCTTCATCACTTTTTGAATCC
                      ____________________________________________________________
consensus AAATTCTCATTAGAAGACTCATCTTCTTTTTCCGAATTATCTTCATCACTTTTTGAATCC
 
. : . : . : . : . : . :
JMFS029D10+ TAAACTCATACTCCATTAACACAAAGCTAGTGTACTGATGAATCAAGAATGAAACTATTT
                      ____________________________________________________________
consensus TAAACTCATACTCCATTAACACAAAGCTAGTGTACTGATGAATCAAGAATGAAACTATTT
 
. : . : . : . : . : . :
JMFS029D10+ CTAAGATAAATTCTACCATTTACAAATTAAAATCTCTCTTTCAACTATGATTATTCAACA
                      ____________________________________________________________
consensus CTAAGATAAATTCTACCATTTACAAATTAAAATCTCTCTTTCAACTATGATTATTCAACA
 
. : . : . : . : . : . :
JMFS029D10+ TAAAATTACTAGATGACGTTGATAATAATAGTATGGATTTATATATATATATATTTTGTA
                      ____________________________________________________________
consensus TAAAATTACTAGATGACGTTGATAATAATAGTATGGATTTATATATATATATATTTTGTA
 
. : . : . : . : . : . :
JMFS029D10+ TTTAGCTGATTGTATTATAAAAATTTATTCAATATAGGTGCATATATATACAATGCTAAT
                      ____________________________________________________________
consensus TTTAGCTGATTGTATTATAAAAATTTATTCAATATAGGTGCATATATATACAATGCTAAT
 
. : . : . : . : . : . :
JMFS029D10+ AAAATATGTATATTTGTGAAGAACAAAACTTTAAAGTATATGGACAAACCGTATTGAAAT
                      ____________________________________________________________
consensus AAAATATGTATATTTGTGAAGAACAAAACTTTAAAGTATATGGACAAACCGTATTGAAAT
 
. : . : . : . : . : . :
JMFS029D10+ TGAAAATGTCTTCTACAAACTTGAGAAGACAATTTGCATCCACATCTATGTCACCATTAG
JMSF019M01+ AAAATGTCCTCTACAAACTTGAGAAGACAATCTGCATCAACATCTATGCCACCATTAG
                      ____________________________________________________________
consensus TGAAAATGTCTTCTACAAACTTGAGAAGACAATTTGCATCCACATCTATGTCACCATTAG
 
. : . : . : . : . : . :
JMFS029D10+ GATGATGTGTATCCTTAACTTGTTCTATGATGATCTTCTCTTCAACATGAGTCATTTGTA
JMSF019M01+ AATTATGTGTATCCTTAACTTGTTCTATGATGATCTTCTCCTCAACATCAATCATTNGTA
                      ____________________________________________________________
consensus GATTATGTGTATCCTTAACTTGTTCTATGATGATCTTCTCTTCAACATGAGTCATTTGTA
 
. : . : . : . : . : . :
JMFS029D10+ GTTGTGAAATTGTTGTTCTTGATGGAGAGAGAGGCTGAGTTGCTATGTCTTGTAGGTAAG
JMSF019M01+ GTTGTGAAATAATTGTTCTTGATAGAGAAAAGGGTTGGTTTGCCATGTCTCGTAGGTAAG
                      ____________________________________________________________
consensus GTTGTGAAATTGTTGTTCTTGATGGAGAGAGGGGTTGGTTTGCTATGTCTTGTAGGTAAG
 
. : . : . : . : . : . :
JMFS029D10+ ATAAGAAGAGGAGAATTGG
JMSF019M01+ ATAAGAAGAGAAGAATTGGCTCTTTGAAAAGGAAATAATAATTAAGATTTACTTGCAGCC
                      ____________________________________________________________
consensus ATAAGAAGAGGAGAATTGGCTCTTTGAAAAGGAAATAATAATTAAGATTTACTTGCAGCC