Previous Contig 005843:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN005I03Sequence491005843 (4)pir|T47746|T477461e-31hypothetical protein F18O21.250 - Arabidopsis thaliana>gb:ATF18O21_1549219 Arabi
JMFN036L21Sequence625005843 (4)pir|T47746|T477461e-45hypothetical protein F18O21.250 - Arabidopsis thaliana>gb:ATF18O21_1549219 Arabi
JMSF019L10Sequence546005843 (4)gb:AP003230_18257511e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P003749005843 (4)pir|T47746|T477465e-46hypothetical protein F18O21.250 - Arabidopsis thaliana>gb:ATF18O21_1549219 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN005I03- GAGAGAACTAGTCTCGAGXXXXXXXXXXXXXXXXXXXXXGATACAACATAAAAGGTATT
                      ____________________________________________________________
consensus GAGAGAACTAGTCTCGAGNNNNNNNNNNNNNNNNNNNNNGATACAACATAAAAGGTATT
 
. : . : . : . : . : . :
JMFN005I03- GAATGGTATAATACTAAAATGTTCTACAAGCCTTTGTATTGCATTGTGTCGATTGACAAG
rJMSF019L10- TGTTCTACAAGCCTTTGTATTGCATTGTGTCGATTGACAAG
                      ____________________________________________________________
consensus GAATGGTATAATACTAAAATGTTCTACAAGCCTTTGTATTGCATTGTGTCGATTGACAAG
 
. : . : . : . : . : . :
JMFN005I03- CAAACATATATACCTGAATTGATATGTAGCACAAACTAACAAAAGAGAAACAAAAATTTT
JMFN036L21+ CATATATACCTGAATGNATATGTAGCACAAACTAACAAAAGAGAAACAAAAATTTT
rJMSF019L10- CAAACATATATACCTGAATTGATATGTAGCACAAACTAACAAAAGAGAAACAAAAATTTT
                      ____________________________________________________________
consensus CAAACATATATACCTGAATTGATATGTAGCACAAACTAACAAAAGAGAAACAAAAATTTT
 
. : . : . : . : . : . :
JMFN005I03- CATGTTTTCAGAGTGGTGTTCTTGATGATGATTCATGAGAAGAGTTTGGTAAAGAAGTTG
JMFN036L21+ CATGTTTTCAGAGTGGTGTTCTTGATGATGATTCATGAGAAGAGTTTGGTAAAGAAGTTG
rJMSF019L10- CATGTTTTCAGAGTGGTGTTCTTGATGATGATTCATGAGAAGAGTTTGGTAAAGAAGTTG
                      ____________________________________________________________
consensus CATGTTTTCAGAGTGGTGTTCTTGATGATGATTCATGAGAAGAGTTTGGTAAAGAAGTTG
 
. : . : . : . : . : . :
JMFN005I03- CCAGAAGTGGCTTTCTTCTCCAGGCATGCAACATGGGCATATCTTCCAAGCTTGTCTACT
JMFN036L21+ CCAGAAGTGGCTTTCTTCTCCAGGCATGCAACATGGGCATATCTTCCAAGCTTGTCTACT
rJMSF019L10- CCAGAAGTGGCTTTCTTCTCCAGGCATGCAACATGGGCATATCTTCCAAGCTTGTCTACT
JMSF019L10+ TCTACT
                      ____________________________________________________________
consensus CCAGAAGTGGCTTTCTTCTCCAGGCATGCAACATGGGCATATCTTCCAAGCTTGTCTACT
 
. : . : . : . : . : . :
JMFN005I03- TGCCTTGCTTCTCCCTTTGTGTCCTTCTTGCAGATTTTGCATGTCTTGTCAACCCATCCC
JMFN036L21+ TGCCTTGCTTCTCCCTTTGTGTCCTTCTTGCAGATTTTGCATGTCTTGTCAACCCATCCC
rJMSF019L10- TGCCTTGCTTCTCCCTTTGTGTCCTTCTTGCAGATTTTGCATGTCTTGTCAACCCATCCC
JMSF019L10+ TGCCTTGCTTCTCCCTTTGTGTCCTTCTTGCAGATTTTGCATGTCTTGTCAACCCATCCC
                      ____________________________________________________________
consensus TGCCTTGCTTCTCCCTTTGTGTCCTTCTTGCAGATTTTGCATGTCTTGTCAACCCATCCC
 
. : . : . : . : . : . :
JMFN005I03- TCTTCCACATACTGCCCATCCACCTCAACATAAGACTTGAAGAAATCCTTGTATGTTCCT
JMFN036L21+ TCTTCCACATACTGCCCATCCACCTCAACATAAGACTTGAAGAAATCCTTGTATGTTCCT
rJMSF019L10- TCTTCCACATACTGCCCATCCACCTCAACATAAGACTTGAAGAAATCCTTGTATGTTCCT
JMSF019L10+ TCTTCCACATACTGCCCATCCACCTCAACATAAGACTTGAAGAAATCCTTGTATGTTCCT
                      ____________________________________________________________
consensus TCTTCCACATACTGCCCATCCACCTCAACATAAGACTTGAAGAAATCCTTGTATGTTCCT
 
. : . : . : . : . : . :
JMFN005I03- CCAATCTTTCTTCTGAGAGCTCCATACTGTTCTCTGGACATTCTCCCTCCGGATTGAGTT
JMFN036L21+ CCAATCTTTCTTCTGAGAGCTCCATACTGTTCTCTGGAAATTCTCCCTCCGGATTGAGTT
rJMSF019L10- CCAATCTTTCTTCTGAGAGCTCCATACTGTTCTCTGGACATTCTCCCTCCGGATTGAGTT
JMSF019L10+ CCAATCTTTCTTCTGAGAGCTCCATACTGTTCTCTGGACATTCTCCCTCCGGATTGAGTT
                      ____________________________________________________________
consensus CCAATCTTTCTTCTGAGAGCTCCATACTGTTCTCTGGACATTCTCCCTCCGGATTGAGTT
 
. : . : . : . : . : . :
JMFN005I03- GCTTCCCTAGCA
JMFN036L21+ GCTTCCCTAGCATCTTCAAGAAGCTCGGCATCTTTGGCGGATCTAACCTGGGAAAAATCG
rJMSF019L10- GCTTCCCTAGCATCTTCAAGAAGCTCGGCATCTTTGGCGGATCTAACCTGGGAAAAATCG
JMSF019L10+ GCTTCCCTAGCATCTTCAAGAAGCTCGGCATCTTTGGCGGATCTAACCTGGGAAAAATCG
                      ____________________________________________________________
consensus GCTTCCCTAGCATCTTCAAGAAGCTCGGCATCTTTGGCGGATCTAACCTGGGAAAAATCG
 
. : . : . : . : . : . :
JMFN036L21+ AGAGCTTCCGTCACACTACTGAACAGAGATTGCTTCCTCTGCGCGGGTTCTTCATCGCTC
rJMSF019L10- AGAGCTTCCGTCACACTACTGAACAGAGATTGCTTCCTCTGCGCGGGTTCTTCATCGCTC
JMSF019L10+ AGAGCTTCCGTCACACTACTGAACAGAGATTGCTTCCTCTGCGCGGGTTCTTCATCGCTC
                      ____________________________________________________________
consensus AGAGCTTCCGTCACACTACTGAACAGAGATTGCTTCCTCTGCGCGGGTTCTTCATCGCTC
 
. : . : . : . : . : . :
JMFN036L21+ TTCTCTTTCTTGGCTGAAACCACGAAAGATTTCTTGAGGCTTCTTCTGCTGGGAACGCCG
rJMSF019L10- TTCTCTTTCTTGGCTGAAACCACGAAAGATTTCTTGAGGCTTCTTCTGCTGGGAACGCCG
JMSF019L10+ TTCTCTTTCTTGGCTGAAACCACGAAAGATTTCTTGAGGCTTCTTCTGCTGGGAACGCCG
                      ____________________________________________________________
consensus TTCTCTTTCTTGGCTGAAACCACGAAAGATTTCTTGAGGCTTCTTCTGCTGGGAACGCCG
 
. : . : . : . : . : . :
JMFN036L21+ CTACAAGTTGAGAGCTTGTGTGCACACCCAGTGTTTGTGAAAATGCCACTCTGTGGAGGC
rJMSF019L10- CTACAAGTTGAGAGCTTGTGTGCACACCCAGTGTTTGTGAAAATGCCACTCTGTGGAGGC
JMSF019L10+ CTACAAGTTGAGAGCTTGTGTGCACACCCAGTGTTTGTGAAAATGCCACTCTGTGGAGGC
                      ____________________________________________________________
consensus CTACAAGTTGAGAGCTTGTGTGCACACCCAGTGTTTGTGAAAATGCCACTCTGTGGAGGC
 
. : . : . : . : . : . :
JMFN036L21+ GTCAAGGTCAGAGCCCTGAGACCCATTTT
rJMSF019L10- GTCAAGGTCAGAGCCCTGAGACCCATTTTTGCTCTGTATAGTTTTCAAGGTTAGTCTTTG
JMSF019L10+ GTCAAGGTCAGAGCCCTGAGACCCATTTTTGCTCTGTATAGTTTTCAAGGTTAGTCTTTG
                      ____________________________________________________________
consensus GTCAAGGTCAGAGCCCTGAGACCCATTTTTGCTCTGTATAGTTTTCAAGGTTAGTCTTTG
 
. : . : . : . : . : . :
rJMSF019L10- GTGCCATTTTTGCTGCTTATATATATTGGTGTGAGGAGACGTTCATGA
JMSF019L10+ GTGCCATTTTTGCTGCTTATATATATTGGTGTGAGGAGACGTTCATGAGGGAGAGTTTTC
                      ____________________________________________________________
consensus GTGCCATTTTTGCTGCTTATATATATTGGTGTGAGGAGACGTTCATGAGGGAGAGTTTTC