Previous Contig 005841:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF019K13Sequence263005841 (2)743011064 (7)pir|T06698|T066981e-32hypothetical protein T29H11.40 - Arabidopsis thaliana>gb:ATT29H11_1555656 Arabid
JMSF052J13Sequence500005841 (2)459011064 (7)gb:AY084634_15697220.008Arabidopsis thaliana clone 113763 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052J13+ AGCAT
                      ____________________________________________________________
consensus AGCAT
 
. : . : . : . : . : . :
JMSF052J13+ TAAANCCATCATCACNTCNTGCNGNGTNTCNTTCCTTAAAAACTCTATCACCCCTATCCC
                      ____________________________________________________________
consensus TAAANCCATCATCACNTCNTGCNGNGTNTCNTTCCTTAAAAACTCTATCACCCCTATCCC
 
. : . : . : . : . : . :
JMSF052J13+ CACTCTCAGCCCAACCTCCGCTCCTATCATCATCACCATAAACATCATATCCATCATGAT
                      ____________________________________________________________
consensus CACTCTCAGCCCAACCTCCGCTCCTATCATCATCACCATAAACATCATATCCATCATGAT
 
. : . : . : . : . : . :
JMSF052J13+ CACCATACGCATGCCCATAACCATCATCGTCACCGACAGATTTTTCTGATCCCCCGTAGC
                      ____________________________________________________________
consensus CACCATACGCATGCCCATAACCATCATCGTCACCGACAGATTTTTCTGATCCCCCGTAGC
 
. : . : . : . : . : . :
JMSF052J13+ TCTGGTTTCTGTCGCGATCGAGATACGCCTGGGTCACCACCAAGTCCTGAAGCTCATCGG
                      ____________________________________________________________
consensus TCTGGTTTCTGTCGCGATCGAGATACGCCTGGGTCACCACCAAGTCCTGAAGCTCATCGG
 
. : . : . : . : . : . :
JMSF052J13+ AGATGGCTCGCATGGCCTTCTCATCATAGTCGTCGTCATCATCATCATCTTCAGACAACA
JMSF019K13+ ATCATCATCATCTTCAGACAACA
                      ____________________________________________________________
consensus AGATGGCTCGCATGGCCTTCTCATCATAGTCGTCGTCATCATCATCATCTTCAGACAACA
 
. : . : . : . : . : . :
JMSF052J13+ GTGGAGGGCTTTGAGGAGGGTTTTGGGGATTGGGATCCGGGGAAAGCGATTGATTTGTGA
JMSF019K13+ GTGGAGGGCTTTGAGGAGGGTTTTGGGGATTGGGATCCGGGGAAAGCGATTGATTTGTGA
                      ____________________________________________________________
consensus GTGGAGGGCTTTGAGGAGGGTTTTGGGGATTGGGATCCGGGGAAAGCGATTGATTTGTGA
 
. : . : . : . : . : . :
JMSF052J13+ GCGATTGAAGCTCAAGCCCTAGCTCTTGATTTTCCGCATCGGATTGGTGTTGATTTTGAA
JMSF019K13+ GCGATTGAAGCTCAAGCCCTAGCTCTTGATTTTCCGCATCGGATTGGTGTTGATTTTGAA
                      ____________________________________________________________
consensus GCGATTGAAGCTCAAGCCCTAGCTCTTGATTTTCCGCATCGGATTGGTGTTGATTTTGAA
 
. : . : . : . : . : . :
JMSF052J13+ GTTGTTCTTCCATTTTGCAAATGTAATTCCGAAACCCTACTCCCGAAAAGTAAAGTTAAT
JMSF019K13+ GTTGTTCTTCCATTTTGCAAATGTAATTCCGAAACCCTACTCCCGAAAAGTAAAGTTAAT
                      ____________________________________________________________
consensus GTTGTTCTTCCATTTTGCAAATGTAATTCCGAAACCCTACTCCCGAAAAGTAAAGTTAAT
 
. : . : . : . : . : . :
JMSF052J13+ TTCGGGTCAAGAACA
JMSF019K13+ TTCGGGTCAAGAACAAGAGGAAGCCAGCCTGCTTCAAACTCAGTTTATTTCCACTTCCCC
                      ____________________________________________________________
consensus TTCGGGTCAAGAACAAGAGGAAGCCAGCCTGCTTCAAACTCAGTTTATTTCCACTTCCCC