Previous Contig 005840:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF015F01Sequence310005840 (2)gb:AC144791_17442600.002Solanum demissum chromosome 5 BAC PGEC668E02 genomic sequence, complete sequence760011819 (2)gb:AC149267_17448861e-33Solanum demissum chromosome 5 clone PGEC747E24 map MAP_LOC, complete sequence.
JMSF019K12Sequence523005840 (2)gb:AC144791_17442606e-04Solanum demissum chromosome 5 BAC PGEC668E02 genomic sequence, complete sequence757011819 (2)gb:AY730334_16253964e-36Solanum tuberosum strain P6/210 clone BAC BA122p13, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF019K12+ TCTGAACCAGCAAACTTCTGCTATTCCAGCTCGATTCAGATCG
                      ____________________________________________________________
consensus TCTGAACCAGCAAACTTCTGCTATTCCAGCTCGATTCAGATCG
 
. : . : . : . : . : . :
JMSF019K12+ GGTGCTGGGAGTTCTTGGCCGGCTTTTTGGCTTCACAGGATCTACTACTACTACTACCTC
                      ____________________________________________________________
consensus GGTGCTGGGAGTTCTTGGCCGGCTTTTTGGCTTCACAGGATCTACTACTACTACTACCTC
 
. : . : . : . : . : . :
JMSF015F01+ GGATCATTCTTCTTATTATGATGGTACTTTGGGGTGCTGGTTGCACCATTCCT
JMSF019K12+ CTCTGCTGGATCATTCTTCTTATTATGATGGTACTTTGGGGTGCTGGTTGCACCATTCCT
                      ____________________________________________________________
consensus CTCTGCTGGATCATTCTTCTTATTATGATGGTACTTTGGGGTGCTGGTTGCACCATTCCT
 
. : . : . : . : . : . :
JMSF015F01+ AGGATGTTCTTCTTCTTCTTCTTCTTCTTCTTCCACTGCTTCTCTGAAGTACTTTTCTGC
JMSF019K12+ AGGATGTTCTTCTTCTTCTTCTTCTTCTTCTTCCACTGCTTCTCTGAAGTACTTTTCTGC
                      ____________________________________________________________
consensus AGGATGTTCTTCTTCTTCTTCTTCTTCTTCTTCCACTGCTTCTCTGAAGTACTTTTCTGC
 
. : . : . : . : . : . :
JMSF015F01+ AGAAAAAACGTCGATTTCTCCGTCTTCTGCTTTGTTTGCCTCTAGATGGACATGCTTTCT
JMSF019K12+ AGAAAAAACGTCGATTTCTCCGTCTTCTGCTTTGTTTGCCTCTAGATGGACATGCTTTCT
                      ____________________________________________________________
consensus AGAAAAAACGTCGATTTCTCCGTCTTCTGCTTTGTTTGCCTCTAGATGGACATGCTTTCT
 
. : . : . : . : . : . :
JMSF015F01+ GGTGCCAGAAATGAAGGGATTAACACCAATCTTGAGTTCAAAGCTTTCTTCATCACCACA
JMSF019K12+ GGTGCCAGAAATGAAGGGATTAACACCAATCTTGAGTTCAAAGCTTTCTTCATCACCACA
                      ____________________________________________________________
consensus GGTGCCAGAAATGAAGGGATTAACACCAATCTTGAGTTCAAAGCTTTCTTCATCACCACA
 
. : . : . : . : . : . :
JMSF015F01+ GTTCAAGTATGAAGGAAGGGAGATGGCTTTTGTGGTTTTGGTGTTTGGTTCTGAAGTTAA
JMSF019K12+ GTTCAAGTATGAAGGAAAGGAGATGGCTTTTGTGGTTTTGGTGTTTGGTTCTGAAGTTAA
                      ____________________________________________________________
consensus GTTCAAGTATGAAGGAAGGGAGATGGCTTTTGTGGTTTTGGTGTTTGGTTCTGAAGTTAA
 
. : . : . : . : . : . :
JMSF015F01+ CACAACCATAGCCATT
JMSF019K12+ CACAACCATAGCCATTGAAACAAACAATTTTTTTGGGTACAGAAATAGTTTTTTGGTAAT
                      ____________________________________________________________
consensus CACAACCATAGCCATTGAAACAAACAATTTTTTTGGGTACAGAAATAGTTTTTTGGTAAT
 
. : . : . : . : . : . :
JMSF019K12+ TTGTTTTTAACAAGCAAACAAAGAGGGAAATGATTCAATAGAAGAAGTATTATGAAGGCC
                      ____________________________________________________________
consensus TTGTTTTTAACAAGCAAACAAAGAGGGAAATGATTCAATAGAAGAAGTATTATGAAGGCC