Previous Contig 005836:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS069G04Sequence619005836 (5)
JMSF009K23Sequence361005836 (5)747022333gb:AB071967_15229772e-11Nicotiana tabacum D31 mRNA for 14-3-3 protein, complete cds.>gb:AB119468_1527920
JMSF019J23Sequence442005836 (5)795010519 (2)gb:AY050348_15621272e-19Arabidopsis thaliana AT4g16420/dl4235c mRNA, complete cds.>gb:AY143911_1583368 A
JMSF019N08Sequence311005836 (5)724022893
JMSF025I21Sequence639005836 (5)695023178gb:AY050348_15621272e-09Arabidopsis thaliana AT4g16420/dl4235c mRNA, complete cds.>gb:AY143911_1583368 A

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF025I21+ TAAAAAAAGAAAAGTAGGAA
                      ____________________________________________________________
consensus TAAAAAAAGAAAAGTAGGAA
 
. : . : . : . : . : . :
JMSF025I21+ AATAATGTAAGGGTGAAATGAAATTGATAATGGAAATGAATAAAAGCTAACCCATCTCTG
                      ____________________________________________________________
consensus AATAATGTAAGGGTGAAATGAAATTGATAATGGAAATGAATAAAAGCTAACCCATCTCTG
 
. : . : . : . : . : . :
JMSF025I21+ CCATTCCGGTCAGTGAAGCAAAGCTTTCAGGCTATGTCTCTGCTTCACATATAAGCCCTC
                      ____________________________________________________________
consensus CCATTCCGGTCAGTGAAGCAAAGCTTTCAGGCTATGTCTCTGCTTCACATATAAGCCCTC
 
. : . : . : . : . : . :
JMSF019N08+ AAAAAAACCAAGGCTTCATCTACATTCCTA
JMFS069G04+ AACAAAAATGATGCAATTTCCATATCAAAAAAAACAAGGCTTCATCTACATTCCTA
JMSF025I21+ CTTCAACAAAAATGATGCAATTTCCATATCAAAAAAAACAAGGCTTCATNTACATTCCTA
                      ____________________________________________________________
consensus CTTCAACAAAAATGATGCAATTTCCATATCAAAAAAAACAAGGCTTCATCTACATTCCTA
 
. : . : . : . : . : . :
JMSF019N08+ AGTTTTTGGTGAAAAATGATACAACGCAAATCTCA-ATCTGTCAAACACCGGGCATAAAC
JMFS069G04+ AGTTTTTTGTGAACAACGATACAGCGTAAGTCTCATATCTGTCAAACACCAGGCATAAAC
JMSF025I21+ AGTTTTTTGTGAACAACGATACAGCGTAAGTCTCATATCTGTCAAACACCAGGCATAAAC
JMSF019J23+ ATAAAC
                      ____________________________________________________________
consensus AGTTTTTTGTGAACAACGATACAGCGTAAGTCTCATATCTGTCAAACACCAGGCATAAAC
 
. : . : . : . : . : . :
JMSF019N08+ ATAAGTACATCAGAGTTCTCT-CTCCATTTTTT
JMFS069G04+ ATAAGTACATCAGAGTTCTCTGCTCCATTTTTTACCCATGAAAGGCTCGCACAATCCCAC
JMSF025I21+ ATAAGTACATCAGAGTTCTCTGCTCCATTTTTTACCCATGAAAGGCTCGCACAATCCCAC
JMSF019J23+ ATAAGTACATCAGAGTTCTCTGCTCCATTTTTTACCCATGAAAGGCTCGCACAATCCCAC
                      ____________________________________________________________
consensus ATAAGTACATCAGAGTTCTCTGCTCCATTTTTTACCCATGAAAGGCTCGCACAATCCCAC
 
. : . : . : . : . : . :
JMFS069G04+ ATCGGAACCAAATGAGGAATATTTCCTCTTAATAAGTCCATAGGTAGAAGCAATGTTCGC
JMSF025I21+ ATCGGAACCAAATGAGGAATATTTCCTCTTAATAAGTCCATAGGTAGAAGCAATGTTCGC
JMSF009K23+ ATTTCTTCTTAATAAGTCCGTAGGTAGAAGATTTGCTCGC
JMSF019J23+ ATCGGAACCAAATGAGGAATATTTCCTCTTAATAAGTCCATAGGTAGAAGCAATGTTCGC
                      ____________________________________________________________
consensus ATCGGAACCAAATGAGGAATATTTCCTCTTAATAAGTCCATAGGTAGAAGCAATGTTCGC
 
. : . : . : . : . : . :
JMFS069G04+ TGGGCTTGGTAGCGCGAGCCTGTAACCTAAGTGGGAGCATTAGAATGGTGGAATAATTTG
JMSF025I21+ TGGGCTTGGTAGCGCGAGCCTGTAACCTAAGTGGGAGCATTAGAATGGTGGAATAATTTG
JMSF009K23+ TGGGCTTGGTAGCGCGAGCCTGTAACCCAAGTGGGAGCATTAAGATGGTGGAATAAATGG
JMSF019J23+ TGGGCTTGGTAGCGCGAGCCTGTAACCTAAGTGGGAGCATTAGAATGGTGGAATAATTTG
                      ____________________________________________________________
consensus TGGGCTTGGTAGCGCGAGCCTGTAACCTAAGTGGGAGCATTAGAATGGTGGAATAATTTG
 
. : . : . : . : . : . :
JMFS069G04+ GCTTACCTTTGAAGGCTGGGCTCGGGGGTGCTATCTACTGGCTTGCCCGTTCCAAGTGGT
JMSF025I21+ GCTTACCTTTGAAGGCTGGGCTCGGGGGTGCTATCTACTGGCTTGCCCGTTCCAAGTGGT
JMSF009K23+ GCTCGCC-TTGAAGGCTGGGCTCGGGGGTGCAATCTACTGGCTTGCCCGTTCCAAGTGAT
JMSF019J23+ GCTTACCTTTGAAGGCTGGGCTCGGGGGTGCTATCTACTGGCTTGCCCGTTCCAAGTGGT
                      ____________________________________________________________
consensus GCTTACCTTTGAAGGCTGGGCTCGGGGGTGCTATCTACTGGCTTGCCCGTTCCAAGTGGT
 
. : . : . : . : . : . :
JMFS069G04+ GAGTCCGGTTGTGGAGTCTCTGCGAAGGCGGAGGCTTCTCGTCTCTTAGACAGGAGGGCA
JMSF025I21+ GAGTCCGGTTGTGGAGTCTCTGCGAAGGCGGAGGCTTCTCGTCTCTTAGACAGGAGGGCA
JMSF009K23+ GAGTCCGGCTGGGAAGCCTCTGCGAAGGCGGAGGCCTCTCGGCCCTTAGATCGGAGGGTA
JMSF019J23+ GAGTCCGGTTGTGGAGTCTCTGCGAAGGCGGAGGCTTCTCGTCTCTTAGACAGGAGGGCA
                      ____________________________________________________________
consensus GAGTCCGGTTGTGGAGTCTCTGCGAAGGCGGAGGCTTCTCGTCTCTTAGACAGGAGGGCA
 
. : . : . : . : . : . :
JMFS069G04+ CCGCGTCAGGCTGGTTTCACAGAGCAGCGAACACCTCCTCCTCTCTGCAGTGGAAG
JMSF025I21+ CCGCGTCAGGCTGGTTTCACAGAGCAGCGAACACCTCCTCCTCTCTGCAGTGGAAGGATA
JMSF009K23+ CCGCGTCAGGCTGGCTTCACAGAGCAGCGAACACCTCTTCCTCTTTGCAGTGGAAGGATA
JMSF019J23+ CCGCGTCAGGCTGGTTTCACAGAGCAGCGAACACCTCCTCCTCTCTGCAGTGGAAGGATA
                      ____________________________________________________________
consensus CCGCGTCAGGCTGGTTTCACAGAGCAGCGAACACCTCCTCCTCTCTGCAGTGGAAGGATA
 
. : . : . : . : . : . :
JMSF025I21+ ACAGGCCAGAGCATCT
JMSF009K23+ ACAGGCCGGAGCATCTTCAGTCCAC
JMSF019J23+ ACAGGCCAGAGCATCTTCAGTCCACTAGCGCCTGATGGGTTCTCCAAATTTAAACCACCC
                      ____________________________________________________________
consensus ACAGGCCAGAGCATCTTCAGTCCACTAGCGCCTGATGGGTTCTCCAAATTTAAACCACCC