Previous Contig 005832:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF016L22Sequence246005832 (2)726012090 (2)pir|D86165|D861652e-24protein F15K9.3 [imported] - Arabidopsis thaliana>gb:AE005172_889357 Arabidopsis
JMSF019I23Sequence392005832 (2)750012090 (2)pir|D86165|D861653e-25protein F15K9.3 [imported] - Arabidopsis thaliana>gb:AE005172_889357 Arabidopsis

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF019I23+ CAGACTGCAGGTCAAGTGATGCAAACTCATTT
                      ____________________________________________________________
consensus CAGACTGCAGGTCAAGTGATGCAAACTCATTT
 
. : . : . : . : . : . :
JMSF019I23+ AGCGTGTTATGGAGCTTTTCCTCTAATAACTCGTATCTCGGGAATTCTGTCAGAGACGGA
                      ____________________________________________________________
consensus AGCGTGTTATGGAGCTTTTCCTCTAATAACTCGTATCTCGGGAATTCTGTCAGAGACGGA
 
. : . : . : . : . : . :
JMSF019I23+ GCCGGTGAATCTACGGGAATGTCTAACGGGAATTCGGACAAAAACTTCCTCTTATTCCTA
                      ____________________________________________________________
consensus GCCGGTGAATCTACGGGAATGTCTAACGGGAATTCGGACAAAAACTTCCTCTTATTCCTA
 
. : . : . : . : . : . :
JMSF019I23+ CTTCCGTTCTCTTGGGTTGAAACAGAAGATACCATCTCATTGCTACCATCATCACTGCCA
                      ____________________________________________________________
consensus CTTCCGTTCTCTTGGGTTGAAACAGAAGATACCATCTCATTGCTACCATCATCACTGCCA
 
. : . : . : . : . : . :
JMSF016L22+ GA
JMSF019I23+ TCCATTTCTTTTTTGCTAACCATTTTGTTCGAACTTCCCCGACTACTCGATTCTTTGGGA
                      ____________________________________________________________
consensus TCCATTTCTTTTTTGCTAACCATTTTGTTCGAACTTCCCCGACTACTCGATTCTTTGGGA
 
. : . : . : . : . : . :
JMSF016L22+ AATGCACAAAATCGGCAAGGTGAAGTCTCCCCGGTTCTTGAGGTGCCTTATAGGCTATGG
JMSF019I23+ AATGCACAAAATCGGCAAGGTGAAGTCTCCCCGGTTCTTGAGGTGCCTTATAGGCTATGG
                      ____________________________________________________________
consensus AATGCACAAAATCGGCAAGGTGAAGTCTCCCCGGTTCTTGAGGTGCCTTATAGGCTATGG
 
. : . : . : . : . : . :
JMSF016L22+ CGCCACTGTTCTTCGAGCTCTTTCGCCCTCGCCTCTGCTCGCCTGAGTGTTCGTTCC
JMSF019I23+ CGCCACTGTTCTTCGAGCTCTTTCGCCCTCGCCTCTGCTCGCCTGAGTGTTCGTTCCACC
                      ____________________________________________________________
consensus CGCCACTGTTCTTCGAGCTCTTTCGCCCTCGCCTCTGCTCGCCTGAGTGTTCGTTCCACC