Previous Contig 005827:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005G24Sequence284005827 (5)
JMSF006M06Sequence385005827 (5)
JMSF019H13Sequence522005827 (5)gb:AY080830_15685240.009Arabidopsis thaliana putative isoleucyl-tRNA synthetase (At5g49030) mRNA, comple
JMSF032G01Sequence716005827 (5)gb:AP004140_18381902e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ15577012833 (3)gb:AY080830_15685244e-35Arabidopsis thaliana putative isoleucyl-tRNA synthetase (At5g49030) mRNA, comple
JMSF047N04Sequence649005827 (5)gb:AP004140_18381902e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ15569012833 (3)gb:AY080830_15685243e-36Arabidopsis thaliana putative isoleucyl-tRNA synthetase (At5g49030) mRNA, comple

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032G01+ CACTTTATGG
                      ____________________________________________________________
consensus CACTTTATGG
 
. : . : . : . : . : . :
JMSF032G01+ TTTTGAAGAAGCTTATAACGATTAATAATGTCCTTCAAAATCTTATTTAAAGCATGCCCC
                      ____________________________________________________________
consensus TTTTGAAGAAGCTTATAACGATTAATAATGTCCTTCAAAATCTTATTTAAAGCATGCCCC
 
. : . : . : . : . : . :
JMSF047N04+ CCCCATTA
JMSF032G01+ ATGTGTAAATCACCATTAGCATAAGGAGGACCATCATGAAGAACAAAATTTGCCCCATTA
                      ____________________________________________________________
consensus ATGTGTAAATCACCATTAGCATAAGGAGGACCATCATGAAGAACAAAATTTGCCCCATTA
 
. : . : . : . : . : . :
JMSF047N04+ TTCCTCTCAGAAACCCTCTTAAAAACCTGGTTTTCATCCCATAGTTTTTGAAGTTCTAGC
JMSF032G01+ TTCCTCTCAGAAACCCTCTTAAAAACCTGGTTTTCATCCCATAGTTTTTGAAGTTCTAGC
                      ____________________________________________________________
consensus TTCCTCTCAGAAACCCTCTTAAAAACCTGGTTTTCATCCCATAGTTTTTGAAGTTCTAGC
 
. : . : . : . : . : . :
JMSF047N04+ TCTCTAATTACAGAATTTGCTCTTAAACTAAATGTTGTCTTTGGCAGATCAACTGTGTGC
JMSF032G01+ TCTCTAATTACAGAATTTGCTCTTAAACTAAATGTTGTCTTTGGCAGATCAACTGTGTGC
                      ____________________________________________________________
consensus TCTCTAATTACAGAATTTGCTCTTAAACTAAATGTTGTCTTTGGCAGATCAACTGTGTGC
 
. : . : . : . : . : . :
JMSF047N04+ TTATACTTCCCATCTTCCTGCTTTGAACCTTCAGATGCTTTTTTGGCCAACATCACAGGT
JMSF032G01+ TTATACTTCCCATCTTCCTGCTTTGAACCTTCAGATGCTTTTTTGGCCAACATCACAGGT
JMSF006M06+ CCTTCAGATGCTTTTTTGGCCAACATCACAGGT
JMSF019H13+ TGCTTTGAACCTTCAGATGCTTTTTTGGCCAACATCACAGGT
                      ____________________________________________________________
consensus TTATACTTCCCATCTTCCTGCTTTGAACCTTCAGATGCTTTTTTGGCCAACATCACAGGT
 
. : . : . : . : . : . :
JMSF047N04+ CCTCGAGACCTCCTTTTTGAAGAAGGAGAAGTGTCGGAGTAGGTACAATAACGAGTCACA
JMSF032G01+ CCTCGAGACCTCCTTTTTGAAGAAGGAGAAGTGTCGGAGTAGGTACAATAACGAGTCACA
JMSF006M06+ CCTCGAGACCTCCTTTTTGAAGAAGGAGAAGTGTCGGAGTAGGTACAATAACGAGTCACA
JMSF019H13+ CCTCGAGACCTCCTTTTTGAAGAAGGAGAAGTGTCGGAGTAGGTACAATAACGAGTCACA
                      ____________________________________________________________
consensus CCTCGAGACCTCCTTTTTGAAGAAGGAGAAGTGTCGGAGTAGGTACAATAACGAGTCACA
 
. : . : . : . : . : . :
JMSF047N04+ TTCAAGAGAGATAAACCTCTAGCTGAAGAGCTGCTTCTTATATTCAATGAGCTAAAATAA
JMSF032G01+ TTCAAGAGAGATAAACCTCTAGCTGAAGAGCTGCTTCTTATATTCAATGAGCTAAAATAA
JMSF006M06+ TTCAAGAGAGATAAACCTCTAGCTGAAGAGCTGCTTCTTATATTCAATGAGCTAAAATAA
JMSF019H13+ TTCAAGAGAGATAAACCTCTAGCTGAAGAGCTGCTTCTTATATTCAATGAGCTAAAATAA
                      ____________________________________________________________
consensus TTCAAGAGAGATAAACCTCTAGCTGAAGAGCTGCTTCTTATATTCAATGAGCTAAAATAA
 
. : . : . : . : . : . :
JMSF047N04+ CTAGTGGTCCTAAATGATGAGGAATTCTTCATTGACCAAGCCTTGTAAGTGGAAGTTTGT
JMSF032G01+ CTAGTGGTCCTAAATGATGAGGAATTCTTCATTGACCAAGCCTTGTAAGTGGAAGTTTGT
JMSF006M06+ CTAGTGGTCCTAAATGATGAGGAATTCTTCATTGACCAAGCCTTGTAAGTGGAAGTTTGT
JMSF005G24+ TAAATGATGAGGAATTCTTCATTGACCAAGCCTTGTAAGTGGAAGTTTGT
JMSF019H13+ CTAGTGGTCCTAAATGATGAGGAATTCTTCATTGACCAAGCCTTGTAAGTGGAAGTTTGT
                      ____________________________________________________________
consensus CTAGTGGTCCTAAATGATGAGGAATTCTTCATTGACCAAGCCTTGTAAGTGGAAGTTTGT
 
. : . : . : . : . : . :
JMSF047N04+ AGAGCCATTTTGAAATGAGAGACAGAGGACGAAATTGGCTTTGTGGAATTGTGGAGAAGG
JMSF032G01+ AGAGCCATTTTGAAATGAGAGACAGAGGACGAAATTGGCTTTGTGGAATTGTGGAGAAGG
JMSF006M06+ AGAGCCATTTTGAAATGAGAGACAGAGGACGAAATTGGCTTTGTGGAATTGTGGAGAAGG
JMSF005G24+ AGAGCCATTTTGAAATGAGAGACAGAGGACGAAATTGGCTTTGTGGAATTGTGGAGAAGG
JMSF019H13+ AGAGCCATTTTGAAATGAGAGACAGAGGACGAAATTGGCTTTGTGGAATTGTGGAGAAGG
                      ____________________________________________________________
consensus AGAGCCATTTTGAAATGAGAGACAGAGGACGAAATTGGCTTTGTGGAATTGTGGAGAAGG
 
. : . : . : . : . : . :
JMSF047N04+ ATAGCTTCCATTTATATGGAACTGCAGCTACTTAAGAAGAAGAAGAAGAAGAAGATACTC
JMSF032G01+ ATAGCTTCCATTTATATGGAACTGCAGCTACTTAAGAAGAAGAAGAAGAAGAAGATACTC
JMSF006M06+ ATAGCTTCCATTTATATGGAACTGCAGCTACTTAAGAAGAAGAAGAAGAAGAAGATACTC
JMSF005G24+ ATAGCTTCCATTTATATGGAACTGCAGCTACTTAAGAAGAAGAAGAAGAAGAAGATACTC
JMSF019H13+ ATAGCTTCCATTTATATGGAACTGCAGCTACTTAAGAAGAAGAAGAAGAAGAAGATACTC
                      ____________________________________________________________
consensus ATAGCTTCCATTTATATGGAACTGCAGCTACTTAAGAAGAAGAAGAAGAAGAAGATACTC
 
. : . : . : . : . : . :
JMSF047N04+ TGTTCCATTTGACTAAGAAAGTGACTGAGGAAGAAGATGGTGTGCGCGGGC
JMSF032G01+ TGTTCCATTTGACTAAGAAAGTGACTGAGGAAGAAGATGGTGTGCGCGGGCGGATAAGCG
JMSF006M06+ TGTTCCATTTGACTAAGAAAGTGACTGAGGAAGAAGATGGTGTGCGCGGGC
JMSF005G24+ TGTTCCATTTGACTAAGAAAGTGACTGAGGAAGAAGATGGTGTGCGCGGGCGGATAAGCG
JMSF019H13+ TGTTCCATTTGACTAAGAAAGTGACTGAGGAAGAAGATGGTGTGCGCGGGCGGATAAGCG
                      ____________________________________________________________
consensus TGTTCCATTTGACTAAGAAAGTGACTGAGGAAGAAGATGGTGTGCGCGGGCGGATAAGCG
 
. : . : . : . : . : . :
JMSF032G01+ AGCGACGAAGCCTGCGATTTTATAGTTTGTAGAGTGTGGAGTAAC
JMSF005G24+ AGCGACGAAGCCTGCGATTTTATAGTTTGTAGAGTGTGGAGTAACAATTTTGT
JMSF019H13+ AGCGACGAAGCCTGCGATTTTATAGTTTGTAGAGTGTGGAGTAACAATTTTGTGGTTAAT
                      ____________________________________________________________
consensus AGCGACGAAGCCTGCGATTTTATAGTTTGTAGAGTGTGGAGTAACAATTTTGTGGTTAAT
 
. : . : . : . : . : . :
JMSF019H13+ TGCATTCCACCACTTGTATTTTCTGAAATTGGGTGTGCCCTGAATTCTGCTGCGCTGCCC
                      ____________________________________________________________
consensus TGCATTCCACCACTTGTATTTTCTGAAATTGGGTGTGCCCTGAATTCTGCTGCGCTGCCC