Previous Contig 005823:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019J11Sequence557005823 (5)gb:AB072919_15231233e-50Nicotiana tabacum NtGT2 mRNA for glucosyltransferase NTGT2, complete cds.731009302 (6)gb:AB072919_15231233e-68Nicotiana tabacum NtGT2 mRNA for glucosyltransferase NTGT2, complete cds.
JMFF023G11Sequence522005823 (5)gb:AB072919_15231238e-44Nicotiana tabacum NtGT2 mRNA for glucosyltransferase NTGT2, complete cds.735009302 (6)gb:AB072919_15231231e-67Nicotiana tabacum NtGT2 mRNA for glucosyltransferase NTGT2, complete cds.
JMFF024B05Sequence514005823 (5)gb:AB072919_15231237e-48Nicotiana tabacum NtGT2 mRNA for glucosyltransferase NTGT2, complete cds.747009302 (6)gb:AB072919_15231234e-70Nicotiana tabacum NtGT2 mRNA for glucosyltransferase NTGT2, complete cds.
JMSF019G17Sequence467005823 (5)gb:AB072919_15231236e-42Nicotiana tabacum NtGT2 mRNA for glucosyltransferase NTGT2, complete cds.802009302 (6)gb:AB072919_15231232e-77Nicotiana tabacum NtGT2 mRNA for glucosyltransferase NTGT2, complete cds.
JMSF044L19Sequence714005823 (5)gb:AB072919_15231231e-73Nicotiana tabacum NtGT2 mRNA for glucosyltransferase NTGT2, complete cds.720009302 (6)gb:AB072919_15231232e-68Nicotiana tabacum NtGT2 mRNA for glucosyltransferase NTGT2, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044L19+ CTTTGAAGGTGGGCATGGCAAAACTGTAATCCCCGCCGGAGCCGGAGGGGAGTA
                      ____________________________________________________________
consensus CTTTGAAGGTGGGCATGGCAAAACTGTAATCCCCGCCGGAGCCGGAGGGGAGTA
 
. : . : . : . : . : . :
JMSF044L19+ GAAACGACGGGAGATCGCCGCTGAACAGGGGAGGAAGCCCAGGTAGTTGGACGGGGCAGT
                      ____________________________________________________________
consensus GAAACGACGGGAGATCGCCGCTGAACAGGGGAGGAAGCCCAGGTAGTTGGACGGGGCAGT
 
. : . : . : . : . : . :
JMFF019J11+ ATGGAAGTAGTAATAGTAAA
JMSF044L19+ TTGGGTCGGTAGCGGCGTTCTTGAAGGCATCCTCGTACCCATGGAAGTAGTAATAGTAAA
                      ____________________________________________________________
consensus TTGGGTCGGTAGCGGCGTTCTTGAAGGCATCCTCGTACCCATGGAAGTAGTAATAGTAAA
 
. : . : . : . : . : . :
JMFF023G11+ GAATCCAGAGCAAGGCGGAAGGGAGGTTGACATCACGCG
JMFF019J11+ TATCCAAAACCGCCGCGGGTTGAATCCAGAGCAAGGCGGAAGGGAGGTTGACATCACGCG
JMFF024B05+ GAATCCAGAGCAAGGCGGAAGGGAGGTTGACATCACGCG
JMSF044L19+ TATCCAAAACCGCCGCGGGTTGAATCCAGAGCAAGGCGGAAGGGAGGTTGACATCACGCG
                      ____________________________________________________________
consensus TATCCAAAACCGCCGCGGGTTGAATCCAGAGCAAGGCGGAAGGGAGGTTGACATCACGCG
 
. : . : . : . : . : . :
JMFF023G11+ CCACCTCGGAAACCCATGGGAGC--AAGAGTATGAACCACGGCCGTGATGGGGCGGCCTT
JMFF019J11+ CCACCTCGGAAACCCATGGGAGC--AAGAGTATGAACCACGGCCGTGATGGGGCGGCCTT
JMFF024B05+ CCACCTCGGAAACCCATGGGAGCAGAAGAGTATGAACCACGGCCGTGATGGGGCGGCCTT
JMSF044L19+ CCACCTCGGAAACCCATGGGAGCAGAAGAGTATGAACCACGGCCGTGATGGGGCGGCCTT
JMSF019G17+ AAGAGTATGAACCACGGCCGTGATGGGGCGGCCTT
                      ____________________________________________________________
consensus CCACCTCGGAAACCCATGGGAGCAGAAGAGTATGAACCACGGCCGTGATGGGGCGGCCTT
 
. : . : . : . : . : . :
JMFF023G11+ GAGCTGCGTTATCGGAAACGATGCCTTTCAGCGACGAGGAGCCGCGGGTCCTGATCTCCG
JMFF019J11+ GAGCTGCGTTATCGGAAACGATGCCTTTCAGCGACGAGGAGCCGCGGGTCCTGATCTCCG
JMFF024B05+ GAGCTGCGTTATCGGAAACGATGCCTTTCAGCGACGAGGAGCCGCGGGTTCTGATCTCCG
JMSF044L19+ GAGCTGCGTTATCGGAAACGATGCCTTTCAGCGACGAGGAGCCGCGGGTTCTGATCTCCG
JMSF019G17+ GAGCTGCGTTATCGGAAACGATGCCTTTCAGCGACGAGGAGCCGCGGGTTCTGATCTCCG
                      ____________________________________________________________
consensus GAGCTGCGTTATCGGAAACGATGCCTTTCAGCGACGAGGAGCCGCGGGTTCTGATCTCCG
 
. : . : . : . : . : . :
JMFF023G11+ ACATGTAGTGCGCGACGTTATGGTGATTTTTTTTGAACCCCTCATCGTAGCCGTCGGAGA
JMFF019J11+ ACATGTAGTGCGCGACGTTATGGTGATTTTTTTTGAACCCCTCATCGTAGCCGTCGGAGA
JMFF024B05+ ACATGTAGTGCGCGACGTTATGGTGATTTTTTTTGAACCCCTCATCGTAGCCGTCGGAGA
JMSF044L19+ ACATGTAGTGCGCGACGTTATGGTGATTTTTTTTGAACCCCTCATCGTAGCCGTCGGAGA
JMSF019G17+ ACATGTAGTGCGCGACGTTATGGTGATTTTTTTTGAACCCCTCATCGTAGCCGTCGGAGA
                      ____________________________________________________________
consensus ACATGTAGTGCGCGACGTTATGGTGATTTTTTTTGAACCCCTCATCGTAGCCGTCGGAGA
 
. : . : . : . : . : . :
JMFF023G11+ AAGCGGTGAAGTTCAAACCATCTGGAACGCCGCCGCCGTTGGCCTTGGACATGAGGCGGT
JMFF019J11+ AAGCGGTGAAGTTCAAACCATCTGGAACGCCGCCGCCGTTGGCCTTGGACATGAGGCGGT
JMFF024B05+ AAGCGGTGAAGTTCAAACCATCTGGAACGCCGCCGCCGTTGGCCTTGGACATGAGGCGGT
JMSF044L19+ AAGCGGTGAAGTTCAAACCATCTGGAACGCCGCCGCCGTTGGCCTTGGACATGAGGCGGT
JMSF019G17+ AAGCGGTGAAGTTCAAACCATCTGGAACGCCGCCGCCGTTGGCCTTGGACATGAGGCGGT
                      ____________________________________________________________
consensus AAGCGGTGAAGTTCAAACCATCTGGAACGCCGCCGCCGTTGGCCTTGGACATGAGGCGGT
 
. : . : . : . : . : . :
JMFF023G11+ GCGCGTAGACGGAGGTGGCGAAGGTGACCTCTATCCCCAAGCGGACGAGGCGCTTCGCAA
JMFF019J11+ GCGCGTAGACGGAGGTGGCGAAGGTGACCTCTATCCCCAAGCGGACGAGGCGCTTCGCAA
JMFF024B05+ GCGCGTAGACGGAGGTGGCGAAGGTGACCTCTATCCCCAAGCGGACGAGGCGCTTCGCAA
JMSF044L19+ GCGCGTAGACGGAGGTGGCGAAGGTGACCTCTATCCCCAAGCGGACGAGGCGCTTCGCAA
JMSF019G17+ GCGCGTAGACGGAGGTGGCGAAGGTGACCTCTATCCCCAAGCGGACGAGGCGCTTCGCAA
                      ____________________________________________________________
consensus GCGCGTAGACGGAGGTGGCGAAGGTGACCTCTATCCCCAAGCGGACGAGGCGCTTCGCAA
 
. : . : . : . : . : . :
JMFF023G11+ ACTGGAGAGATGGGTTGATACGGCCTTGCGCCGGGAAGGTAACCAGAAGAATATGAGGCT
JMFF019J11+ ACTGGAGAGATGGGTTGATACGGCCTTGCGCCGGGAAGGTAACCAGAAGAATATGAGGCT
JMFF024B05+ ACTGGAGAGATGGGTTGATATGGCCTTGCGCCGGGAAGGTAACCAGAAGAATATGAGGCT
JMSF044L19+ ACTGGAGAGATGGGTTGATATGGCCTTGCGCCGGGAAGGTAACCAGAAGAATATGAGGCT
JMSF019G17+ ACTGGAGAGATGGGTTGATATGGCCTTGCGCCGGGAAGGTAACCAGAAGAATATGAGGCT
                      ____________________________________________________________
consensus ACTGGAGAGATGGGTTGATATGGCCTTGCGCCGGGAAGGTAACCAGAAGAATATGAGGCT
 
. : . : . : . : . : . :
JMFF023G11+ GCACCATTGCCACGCCAACCAAGAAAGAACGTAACTAGATGGAGGAAGATATATCCGACA
JMFF019J11+ GCACCATTGCCACGCCAACCAAGAAAGAACGTAACTAGATGGAGGAAGATATATCCGACA
JMFF024B05+ GCACCATTGCCACGCCAACCAAGAAAGAACGTAACTAGATGGAGGAAGATATATCCGACA
JMSF044L19+ GCACCATTGCCACGCCAACCAAGAAAGAACGTAACTAGATGGAGGAAGATATATCCGACA
JMSF019G17+ GCACCATTGCCACGCCAACCAAGAAAGAACGTAACTAGATGGAGGAAGATATATCCGACA
                      ____________________________________________________________
consensus GCACCATTGCCACGCCAACCAAGAAAGAACGTAACTAGATGGAGGAAGATATATCCGACA
 
. : . : . : . : . : . :
JMFF023G11+ AGGGAAATTAGATATTTTTAGGTTGTTTGGAGATTAGAGTTGTGATTCTGTTTGCGTGC
JMFF019J11+ AGGGAAATTAGATATTTTTAGGTTGTTTGGAGATTAGAGTTGTGATTCTGTTTGCGTGC
JMFF024B05+ AGGGAAATTAGATATTTTTAGGTTGTTTGGAGATTAGAGTTGTGATTCTGTTTG
JMSF044L19+ AGGGAAATTAGATATTTTTAGGTTGTTTGGAGATTAGAGTTGTGATTCTGTTTGTGTGC
JMSF019G17+ AGGGAAATTAGATATTTTTAGGTTGTTTGGAGATTAGAGTTGTGATTCTGTTTGTGTGCC
                      ____________________________________________________________
consensus AGGGAAATTAGATATTTTTAGGTTGTTTGGAGATTAGAGTTGTGATTCTGTTTGTGTGCC