Previous Contig 005818:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS157C03Sequence626005818 (4)gb:AB028621_15180661e-43Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MUJ8.>gb:AY113003_15781
JMSF019F21Sequence258005818 (4)796013585 (2)gb:AB028621_15180664e-75Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MUJ8.>gb:AY113003_15781
JMSF035D07Sequence670019838pir|T51598|T515983e-09high mobility group protein HMG-beta2 [validated] - Arabidopsis thaliana>gb:ATHM717005818 (4)gb:AB073921_15232282e-12Ipomoea nil transposon Tpn8 DNA, complete sequence.
JMSF045B02Sequence791005818 (4)gb:AB028621_1518066e-132Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MUJ8.>gb:AY113003_15781775013585 (2)gb:AB028621_15180664e-72Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MUJ8.>gb:AY113003_15781

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF035D07- CAAAGAACTAATTAACAAGTCTAA
                      ____________________________________________________________
consensus CAAAGAACTAATTAACAAGTCTAA
 
. : . : . : . : . : . :
rJMSF035D07- ATACTTCCATGAACAACTCTAATCGAATCATATATCATCCAAGTCATAATACTACAAAAA
                      ____________________________________________________________
consensus ATACTTCCATGAACAACTCTAATCGAATCATATATCATCCAAGTCATAATACTACAAAAA
 
. : . : . : . : . : . :
rJMSF035D07- AAATTCACGAACCAAGTCTAAGGATGCCAACTTCAAACCCAGCTCCTTTACTCTGTCCGT
                      ____________________________________________________________
consensus AAATTCACGAACCAAGTCTAAGGATGCCAACTTCAAACCCAGCTCCTTTACTCTGTCCGT
 
. : . : . : . : . : . :
rJMSF035D07- GTACCATGTCAAAGAGCTAGAACTTTCACTGAACTTCCTCTCTACATCAGAAAGTACATC
                      ____________________________________________________________
consensus GTACCATGTCAAAGAGCTAGAACTTTCACTGAACTTCCTCTCTACATCAGAAAGTACATC
 
. : . : . : . : . : . :
rJMSF035D07- AGAAAGTTTAACAGACATGTATATGCCTCAAGTTTGGAATGAGTTTTACGAAGGTTTATG
                      ____________________________________________________________
consensus AGAAAGTTTAACAGACATGTATATGCCTCAAGTTTGGAATGAGTTTTACGAAGGTTTATG
 
. : . : . : . : . : . :
rJMSF035D07- AGATCATTGACTTTGGTAGTTAACTCATCATTAAGCCATGTGTGATGCCTCTCAATTAGT
                      ____________________________________________________________
consensus AGATCATTGACTTTGGTAGTTAACTCATCATTAAGCCATGTGTGATGCCTCTCAATTAGT
 
. : . : . : . : . : . :
rJMSF035D07- ATCATGATGTACATGATACTAACAAAGACATGTTTCTCATAGATATGTGACCTCCTTGAA
                      ____________________________________________________________
consensus ATCATGATGTACATGATACTAACAAAGACATGTTTCTCATAGATATGTGACCTCCTTGAA
 
. : . : . : . : . : . :
rJMSF035D07- GTATACTTTCTTCAAAATCTCTACAAAAAGTGTCACATTTTCTCCCTCATTAATGTAATC
JMSF045B02+ CAAAAAGTGTCCCATTTTCTCCCTCATTAACGTAATC
                      ____________________________________________________________
consensus GTATACTTTCTTCAAAATCTCTACAAAAAGTGTCCCATTTTCTCCCTCATTAATGTAATC
 
. : . : . : . : . : . :
rJMSF035D07- AAGCTCTTCAAAGAAGAGAGCAGCCCATTCATCAACTAATCC
JMSF045B02+ AAGCTCTTCAAAGAAGCGAGCAGCCCATTCATCAACTAATCCGACCACATCAACTGAGAT
                      ____________________________________________________________
consensus AAGCTCTTCAAAGAAGCGAGCAGCCCATTCATCAACTAATCCGACCACATCAACTGAGAT
 
. : . : . : . : . : . :
JMSF045B02+ CTGTGGAAATTTCCTAAGAAATAGACCCAAATTCCGAATAATGAATAAATCGACTGTAAC
                      ____________________________________________________________
consensus CTGTGGAAATTTCCTAAGAAATAGACCCAAATTCCGAATAATGAATAAATCGACTGTAAC
 
. : . : . : . : . : . :
JMSF045B02+ AGTCTCAAGGACAAATGGTCTCTGTACTTTAACAGCTACCAAATCTCCATTCTCTTTGAG
                      ____________________________________________________________
consensus AGTCTCAAGGACAAATGGTCTCTGTACTTTAACAGCTACCAAATCTCCATTCTCTTTGAG
 
. : . : . : . : . : . :
JMSF045B02+ CCGACCTTTATACACCTGTCCTAGAGATGCAGCAGCAATTGGGGAGGGAGAAAGTTCCGA
                      ____________________________________________________________
consensus CCGACCTTTATACACCTGTCCTAGAGATGCAGCAGCAATTGGGGAGGGAGAAAGTTCCGA
 
. : . : . : . : . : . :
JMSF045B02+ ATAGATGTTATACCAAGGCTGTCCAAGTTCCTCCTCAATAAGGGCCATGGCAACATCATC
                      ____________________________________________________________
consensus ATAGATGTTATACCAAGGCTGTCCAAGTTCCTCCTCAATAAGGGCCATGGCAACATCATC
 
. : . : . : . : . : . :
JMSF045B02+ CGGAAATGATGGAACCTTGTCACAAAGCTTTTGCAGCTCAACCATTGCAACTGGTGATAG
                      ____________________________________________________________
consensus CGGAAATGATGGAACCTTGTCACAAAGCTTTTGCAGCTCAACCATTGCAACTGGTGATAG
 
. : . : . : . : . : . :
JMSF045B02+ TATATCAGGTCGAATGCTTAATGCCTGCCCTAGTTTAATATATGCTGGACCCAGGGACGT
                      ____________________________________________________________
consensus TATATCAGGTCGAATGCTTAATGCCTGCCCTAGTTTAATATATGCTGGACCCAGGGACGT
 
. : . : . : . : . : . :
JMSF045B02+ TACAATCTCCCTCAGTTCAATAGCTCGGGCAACCTCATTCTCTTTGACTTTTTTGTTTAT
                      ____________________________________________________________
consensus TACAATCTCCCTCAGTTCAATAGCTCGGGCAACCTCATTCTCTTTGACTTTTTTGTTTAT
 
. : . : . : . : . : . :
JMSF045B02+ TACATCCGAGGCAATGCGTGAAAGAAAACCTCCAGCAACAGACAATAATTGCACAATACG
JMFS157C03+ ACATCCGAGGCAATGCGTGAAAGAAACCCTCCAGCAACAGACAATAATTGCACAATACG
                      ____________________________________________________________
consensus TACATCCGAGGCAATGCGTGAAAGAAACCCTCCAGCAACAGACAATAATTGCACAATACG
 
. : . : . : . : . : . :
JMSF045B02+ TGTTGCAACAGCATTTGGCCTTTTCCCCCAATATGCAGCAATGCTAGCAGGCTCATATAC
JMFS157C03+ TGTTGCAACAGCATTTGGCCTTTTCCCCCAATATGCAGCAATGCTAGCAGGCTCATATAC
                      ____________________________________________________________
consensus TGTTGCAACAGCATTTGGCCTTTTCCCCCAATATGCAGCAATGCTAGCAGGCTCATATAC
 
. : . : . : . : . : . :
JMSF045B02+ TAAAGGCAGGAACTCACTGCTCTCATCAACCTCAACTAGGCGAAGCTTAATATTGTTATC
JMFS157C03+ TAAAGGCAGGAACTCACTGCTCTCATCAACCTCAACTAGGCGAAGCTTAATATTGTTATC
                      ____________________________________________________________
consensus TAAAGGCAGGAACTCACTGCTCTCATCAACCTCAACTAGGCGAAGCTTAATATTGTTATC
 
. : . : . : . : . : . :
JMSF045B02+ TGCAAACTGAGAATCCTTCAGATTTTGACCTCGTAGCCCCCTCATTAATATGGCTACTTG
JMFS157C03+ TGCAAACTGAGAATCCTTCAGATTTTGACCTCGTAGCCCCCTCATTAATATGGCTACTTG
                      ____________________________________________________________
consensus TGCAAACTGAGAATCCTTCAGATTTTGACCTCGTAGCCCCCTCATTAATATGGCTACTTG
 
. : . : . : . : . : . :
JMSF045B02+ CTCATTTTCTTCCATTTGTGCCCTTACTCTC
JMFS157C03+ CTCATTTTCTTCCATTTGTGCCCTTACTCTCTTGATCTCTTGTGATACATCCTGCATTCT
                      ____________________________________________________________
consensus CTCATTTTCTTCCATTTGTGCCCTTACTCTCTTGATCTCTTGTGATACATCCTGCATTCT
 
. : . : . : . : . : . :
JMFS157C03+ TGTAGAGACTCCATTTACTGGCTTGGGGGATCCGTTGACTACTTTGGACGAAGAAGGCTT
                      ____________________________________________________________
consensus TGTAGAGACTCCATTTACTGGCTTGGGGGATCCGTTGACTACTTTGGACGAAGAAGGCTT
 
. : . : . : . : . : . :
JMFS157C03+ GGTGTCAGACGGCTTAGGCTCAGTTGCAATGGCACGCACGGCGGCGTTCGGTGTCCGAAT
                      ____________________________________________________________
consensus GGTGTCAGACGGCTTAGGCTCAGTTGCAATGGCACGCACGGCGGCGTTCGGTGTCCGAAT
 
. : . : . : . : . : . :
JMFS157C03+ CCTCGGAAACGACCGGCGGTTGCTGGCGGCCTTCAAAAAGGGAACGGAAACAGTACGAGA
JMSF019F21+ AACGGAANCAGTACGAGA
                      ____________________________________________________________
consensus CCTCGGAAACGACCGGCGGTTGCTGGCGGCCTTCAAAAAGGGAACGGAAACAGTACGAGA
 
. : . : . : . : . : . :
JMFS157C03+ CGGCAGAGAGGTGCAAGGCCTGCAGAAGACGAGCTGCGAAGCTGCGTCCATTGTTGGGGA
JMSF019F21+ CGGCAGAGAGGTGCAAGGCCTGCAGAAGACGAGCTGCGAAGCTGCGTCCATTGTTGCGGA
                      ____________________________________________________________
consensus CGGCAGAGAGGTGCAAGGCCTGCAGAAGACGAGCTGCGAAGCTGCGTCCATTGTTGGGGA
 
. : . : . : . : . : . :
JMFS157C03+ ATCAACAATTCAGATACTGCTAAGCTACCAAAAATCTAAAGATAAGAACTCAAATGAAAA
JMSF019F21+ ATCAACAATTCAGATACTGCTAAGCTACCAAAAATCTAAAGATAAGAACTCAAATGAAAA
                      ____________________________________________________________
consensus ATCAACAATTCAGATACTGCTAAGCTACCAAAAATCTAAAGATAAGAACTCAAATGAAAA
 
. : . : . : . : . : . :
JMFS157C03+ TTATGTAGAAATTTGAATTGAATTTGA
JMSF019F21+ TTATGTAGAAATTTGAATTGAATTTGAGAGCGTGAGGATCTGTGAGTAAGCGGGAGTGGA
                      ____________________________________________________________
consensus TTATGTAGAAATTTGAATTGAATTTGAGAGCGTGAGGATCTGTGAGTAAGCGGGAGTGGA
 
. : . : . : . : . : . :
JMSF019F21+ GAGGATCGCAGCAGTGTATATTCGTTGTTTGTGACACACGCGAGTGGGTTATGGCTGTTC
                      ____________________________________________________________
consensus GAGGATCGCAGCAGTGTATATTCGTTGTTTGTGACACACGCGAGTGGGTTATGGCTGTTC