Previous Contig 005814:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006H08Sequence622005814 (18)gb:AY787627_16284026e-94Centella asiatica farnesyl diphosphate synthase (FPS) mRNA, complete cds.793005814 (18)gb:AY787627_16284021e-95Centella asiatica farnesyl diphosphate synthase (FPS) mRNA, complete cds.
JMFF009M20Sequence574005814 (18)gb:AY787627_16284028e-86Centella asiatica farnesyl diphosphate synthase (FPS) mRNA, complete cds.660005814 (18)gb:AY787627_16284025e-71Centella asiatica farnesyl diphosphate synthase (FPS) mRNA, complete cds.
JMFF020F17Sequence571005814 (18)gb:AY787627_16284025e-77Centella asiatica farnesyl diphosphate synthase (FPS) mRNA, complete cds.750005814 (18)gb:AY787627_16284028e-98Centella asiatica farnesyl diphosphate synthase (FPS) mRNA, complete cds.
JMFF034J21Sequence577005814 (18)gb:AF384040_17941494e-84Mentha x piperita farnesyl diphosphate synthase mRNA, complete cds.651005814 (18)gb:AY787627_16284025e-71Centella asiatica farnesyl diphosphate synthase (FPS) mRNA, complete cds.
JMFF051P01Sequence603005814 (18)gb:AY787627_16284026e-74Centella asiatica farnesyl diphosphate synthase (FPS) mRNA, complete cds.493005814 (18)gb:CAFPS_16448931e-48C.annuum mRNA for farnesyl pyrophosphate synthase.
JMFN003G17Sequence587005814 (18)gb:AY787627_16284025e-91Centella asiatica farnesyl diphosphate synthase (FPS) mRNA, complete cds.
JMFN032N07Sequence599005814 (18)gb:CAFPS_16448933e-56C.annuum mRNA for farnesyl pyrophosphate synthase.
JMFN033D09Sequence594005814 (18)gb:AY787627_16284026e-91Centella asiatica farnesyl diphosphate synthase (FPS) mRNA, complete cds.
JMSF019E21Sequence249005814 (18)gb:AF384040_17941493e-25Mentha x piperita farnesyl diphosphate synthase mRNA, complete cds.792005814 (18)gb:AY787627_16284022e-96Centella asiatica farnesyl diphosphate synthase (FPS) mRNA, complete cds.
JMSF020E21Sequence582003218 (8)gb:AY035044_15598222e-52Arabidopsis thaliana unknown protein (At5g19820) mRNA, complete cds.>gb:AY051083707005814 (18)gb:AY787627_16284029e-79Centella asiatica farnesyl diphosphate synthase (FPS) mRNA, complete cds.
JMSF049J08Sequence685005814 (18)gb:AY787627_1628402e-106Centella asiatica farnesyl diphosphate synthase (FPS) mRNA, complete cds.738005814 (18)pir|T06272|T062721e-88farnesyl-pyrophosphate synthetase FPS1 - tomato>gb:AF048747_1763990 Lycopersicon

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN032N07+ AAGAAAAGAAAATGCAGTTTTATTTCAACTTAGAATGCTG
rJMFF009M20- TTCACTTAGAATGCTG
rJMFF034J21- ACTTAGAATGCTG
rJMFF006H08- ACTTAGAATGCTG
rJMSF049J08- CTG
rJMSF020E21- CTG
rJMSF019E21- GCTG
                      ____________________________________________________________
consensus AAGAAAAGAAAATGCAGTTTTATTTTCACTTAGAATGCTG
 
. : . : . : . : . : . :
rJMFF051P01- ACTACAACAAACAGGAGCATGATATCAAAGTAAATGGGGAACTG
JMFN032N07+ GGCATCAGAGT-GAATACTACAACAAACAGGAGCATGATATCAAAGTAAATGGGGAACTG
rJMFF009M20- GGCATCAGAGT-GAATACTACAACAAACAGGAGCATGATATCAAAGTAAATGGGGAACTG
rJMFF034J21- GGCATCAGAGT-GAATACTACAACAAACAGGAGCATGATATCAAAGTAAATGGGGAACTG
rJMFF006H08- GGCATCAGAGT-GAATACTACAACAAACAGGAGCATGATATCAAAGTAAATGGGGAACTG
rJMSF049J08- GGCATCAGAGT-GAATACTACAACAAACAGGAGCATGATATCAAAGTAAATGGGGAACTG
rJMSF020E21- GGCATCAGAGTGGAATACTACAACAAACAGGAGCATGATATCAAAGTAAATGGGGAACTG
rJMSF019E21- GGCATCAGAGT-GAATACTACAACAAACAGGAGCATGATATCAAAGTAAATGGGGAACTG
rJMFF020F17- GTAAATGGGGAACTG
                      ____________________________________________________________
consensus GGCATCAGAGT-GAATACTACAACAAACAGGAGCATGATATCAAAGTAAATGGGGAACTG
 
. : . : . : . : . : . :
rJMFF051P01- AACTCAGTTATGGTAAGCCTAGCAACAAATGCAGAAGATCCATCATGAAAATATTATGCC
JMFN032N07+ AACTCAGTTATGGTAAGCCTAGCAACAAATGCAGAAGATCCATCATGAAAATATTATGCC
rJMFF009M20- AACTCAGTTATGGTAAGCCTAGCAACAAATGCAGAAGATCCATCATGAAAATATTATGCC
rJMFF034J21- AACTCAGTTATGGTAAGCCTAGCAACAAATGCAGAAGATCCATCATGAAAATATTATGCC
rJMFF006H08- AACTCAGTTATGGTAAGCCTAGCAACAAATGCAGAAGATCCATCATGAAAATATTATGCC
rJMSF049J08- AACTCAGTTATGGTAAGCCTAGCAACAAATGCAGAAGATCCATCATGAAAATATTATGCC
rJMSF020E21- AACTCAGTTATGGTAAGCCTAGCAACAAATGCAGAAGATCCATCATGAAAATATTATGCC
rJMSF019E21- AACTCAGTTATGGTAAGCCTAGCAACAAATGCAGAAGATCCATCATGAAAATATTATGCC
rJMFF020F17- AACTCAGTTATGGTAAGCCTAGCAACAAATGCAGAAGATCCATCATGAAAATATTATGCC
                      ____________________________________________________________
consensus AACTCAGTTATGGTAAGCCTAGCAACAAATGCAGAAGATCCATCATGAAAATATTATGCC
 
. : . : . : . : . : . :
rJMFF051P01- ACAAGAAATTAAAACAACACAAACACAATGTGCCATCCAATCCAAACTACTTTTGCCTCT
JMFN032N07+ ACAAGAAATTAAAACAACACAAACACAATGTGCCATCCAATCCAAACTACTTTTGCCTCT
rJMFF009M20- ACAAGAAATTAAAACAACACAAACACAATGTGCCATCCAATCCAAACTACTTTTGCCTCT
rJMFF034J21- ACAAGAAATTAAAACAACACAAACACAATGTGCCATCCAATCCAAACTACTTTTGCCTCT
rJMFF006H08- ACAAGAAATTAAAACAACACAAACACAATGTGCCATCCAATCCAAACTACTTTTGCCTCT
rJMSF049J08- ACAAGAAATTAAAACAACACAAACACAATGTGCCATCCAATCCAAACTACTTTTGCCTCT
rJMSF020E21- ACAAGAAATTAAAACAACACAAACACAATGTGCCATCCAATCCAAACTACTTTTGCCTCT
rJMSF019E21- ACAAGAAATTAAAACAACACAAACACAATGTGCCATCCAATCCAAACTACTTTTGCCTCT
rJMFF020F17- ACAAGAAATTAAAACAACACAAACACAATGTGCCATCCAATCCAAACTACTTTTGCCTCT
                      ____________________________________________________________
consensus ACAAGAAATTAAAACAACACAAACACAATGTGCCATCCAATCCAAACTACTTTTGCCTCT
 
. : . : . : . : . : . :
rJMFF051P01- TGTATATCTTGGCCAAGAATGATTTCAACACTGCTTGTACAGCTGCACTTGGATGGCCTT
JMFN032N07+ TGTATATCTTGGCCAAGAATGATTTCAACACTGCTTGTACAGCTGCACTTGGATGGCCTT
rJMFF009M20- TGTATATCTTGGCCAAGAATGATTTCAACACTGCTTGTACAGCTGCACTTGGATGGCCTT
rJMFF034J21- TGTATATCTTGGCCAAGAATGATTTCAACACTGCTTGTACAGCTGCACTTGGATGGCCTT
rJMFF006H08- TGTATATCTTGGCCAAGAATGATTTCAACACTGCTTGTACAGCTGCACTTGGATGGCCTT
rJMSF049J08- TGTATATCTTGGCCAAGAATGATTTCAACACTGCTTGTACAGCTGCACTTGGATGGCCTT
rJMSF020E21- TGTATATCTTGGCCAAGAATGATTTCAACACTGCTTGTACAGCTGCACTTGGATGGCCTT
rJMSF019E21- TGTATATCTTGGCCAAGAATGATTTCAACACTGCTTGTACAGCTGCACTTGGATGGCCTT
rJMFF020F17- TGTATATCTTGGCCAAGAATGATTTCAACACTGCTTGTACAGCTGCACTTGGATGGCCTT
                      ____________________________________________________________
consensus TGTATATCTTGGCCAAGAATGATTTCAACACTGCTTGTACAGCTGCACTTGGATGGCCTT
 
. : . : . : . : . : . :
rJMFF051P01- CAATCGACCTTACTATCCTTTCATAGCTCTTGCTCTCGTATTCTGCAAACACATCCTCAA
JMFN032N07+ CAATCGACCTTACTATCCTTTCATAGCTCTTGCTCTCGTATTCTGCAAACACATCCTCAA
rJMFF009M20- CAATCGACCTTACTATCCTTTCATAGCTCTTGCTCTCGTATTCTGCAAACACATCCTCAA
rJMFF034J21- CAATCGACCTTACTATCCTTTCATAGCTCTTGCTCTCGTATTCTGCAAACACATCCTCAA
rJMFF006H08- CAATCGACCTTACTATCCTTTCATAGCTCTTGCTCTCGTATTCTGCAAACACATCCTCAA
rJMSF049J08- CAATCGACCTTACTATCCTTTCATAGCTCTTGCTCTCGTATTCTGCAAACACATCCTCAA
rJMSF020E21- CAATCGACCTTACTATCCTTTCATAGCTCTTGCTCTCGTATTCTGCAAACACATCCTCAA
rJMSF019E21- CAATCGACCTTACTATCCTTTCATAGCTCTTGCTCTCGTATTCTGCAAACACATCCTCAA
rJMFF020F17- CAATCGACCTTACTATCCTTTCATAGCTCTTGCTCTCGTATTCTGCAAACACATCCTCAA
                      ____________________________________________________________
consensus CAATCGACCTTACTATCCTTTCATAGCTCTTGCTCTCGTATTCTGCAAACACATCCTCAA
 
. : . : . : . : . : . :
rJMFF051P01- GTTTGATCTCATTGTAAAGCACTTTAATCTTAGCTACGCAAGCAGAATCCTCTTTTCCAT
JMFN032N07+ GTTTGATCTCATTGTAAAGCACTTTAATCTTAGCTACGCAAGCAGAATCCTCTTTTCCAT
rJMFF009M20- GTTTGATCTCATTGTAAAGCACTTTAATCTTAGCTACGCAAGCAGAATCCTCTTTTCCAT
rJMFF034J21- GTTTGATCTCATTGTAAAGCACTTTAATCTTAGCTACGCAAGCAGAATCCTCTTTTCCAT
rJMFF006H08- GTTTGATCTCATTGTAAAGCACTTTAATCTTAGCTACGCAAGCAGAATCCTCTTTTCCAT
rJMSF049J08- GTTTGATCTCATTGTAAAGCACTTTAATCTTAGCTACGCAAGCAGAATCCTCTTTTCCAT
rJMSF020E21- GTTTGATCTCATTGTAAAGCACTTTAATCTTAGCTACGCAAGCAGAATCCTCTTTTCCAT
rJMSF019E21- GTTTGATCTCATTGTAAAGCACTTTAATCTTAGCTACGCAAGCAGAATCCTCTTTTCCAT
rJMFF020F17- GTTTGATCTCATTGTAAAGCACTTTAATCTTAGCTACGCAAGCAGAATCCTCTTTTCCAT
                      ____________________________________________________________
consensus GTTTGATCTCATTGTAAAGCACTTTAATCTTAGCTACGCAAGCAGAATCCTCTTTTCCAT
 
. : . : . : . : . : . :
rJMFF051P01- AGTTCTCATATAGTGTCTTCTTTTGTTCCTCGTTACAAAGTTCCAGTGCTTTCACAACCA
JMFN032N07+ AGTTCTCATATAGTGTCTTCTTTTGTTCCTCGTTACAAAGTTCCAGTGCTTTCACAACCA
rJMFF009M20- AGTTCTCATATAGTGTCTTCTTTTGTTCCTCGTTACAAAGTTCCAGTGCTTTCACAACCA
rJMFF034J21- AGTTCTCATATAGTGTCTTCTTTTGTTCCTCGTTACAAAGTTCCAGTGCTTTCACAACCA
rJMFF006H08- AGTTCTCATATAGTGTCTTCTTTTGTTCCTCGTTACAAAGTTCCAGTGCTTTCACAACCA
rJMSF049J08- AGTTCTCATATAGTGTCTTCTTTTGTTCCTCGTTACAAAGTTCCAGTGCTTTCACAACCA
rJMSF020E21- AGTTCTCATATAGTGTCTTCTTTTGTTCCTCGTTACAAAGTTCCAGTGCTTTCACAACCA
rJMSF019E21- AGTTCTCATATAGTGTCTTCTTTTGTTCCTCGTTACAAAGTTCCAGTGCTTTCACAACCA
rJMFF020F17- AGTTCTCATATAGTGTCTTCTTTTGTTCCTCGTTACAAAGTTCCAGTGCTTTCACAACCA
                      ____________________________________________________________
consensus AGTTCTCATATAGTGTCTTCTTTTGTTCCTCGTTACAAAGTTCCAGTGCTTTCACAACCA
 
. : . : . : . : . : . :
rJMFF051P01- ACCACGAGCACTTAAAGTCTTCAATGTCTGTTCCAATCTTGCCAAGAACCTTTGGATCAG
JMFN032N07+ ACCACGAGCACTTAAAGTCTTCAATGTCTGTTCCAATCTTGCCAAGAACCTTTGGATCAG
rJMFF009M20- ACCACGAGCACTTAAAGTCTTCAATGTCTGTTCCAATCTTGCCAAGAACCTTTGGATCAG
rJMFF034J21- ACCACGAGCACTTAAAGTCTTCAATGTCTGTTCCAATCTTGCCAAGAACCTTTGGATCAG
rJMFF006H08- ACCACGAGCACTTAAAGTCTTCAATGTCTGTTCCAATCTTGCCAAGAACCTTTGGATCAG
rJMSF049J08- ACCACGAGCACTTAAAGTCTTCAATGTCTGTTCCAATCTTGCCAAGAACCTTTGGATCAG
rJMSF020E21- ACCACGAGCACTTAAAGTCTTCAATGTCTGTTCCAATCTTGCCAAGAACCTTTGGATCAG
rJMSF019E21- ACCACGAGCACTTAAAGTCTTCAATGTCTGTTCCAATCTTGCCAAGAACCTTTGGATCAG
rJMFF020F17- ACCACGAGCACTTAAAGTCTTCAATGTCTGTTCCAATCTTGCCAAGAACCTTTGGATCAG
                      ____________________________________________________________
consensus ACCACGAGCACTTAAAGTCTTCAATGTCTGTTCCAATCTTGCCAAGAACCTTTGGATCAG
 
. : . : . : . : . : . :
rJMFF051P01- CAAAGCAATCCAGATAATCATCCTGAACT
JMFN032N07+ CAAAGCAATCCAGATAATCATCCTGAACTTGAAAATAGATTCCCATATCAACAAGAATGT
rJMFF009M20- CAAAGCAATCCAGATAATCATCCTGAACTTGAAAATAGATTCCCATATCAACAAGAATGT
rJMFF034J21- CAAAGCAATCCAGATAATCATCCTGAACTTGAAAATAGATTCCCATATCAACAAGAATGT
rJMFF006H08- CAAAGCAATCCANATAATCATCCTGAACTTGAAAATAGATTCCCATATCAACAAGAATGT
rJMSF049J08- CAAAGCAATCCAGATAATCATCCTGAACTTGAAAATAGATTCCCATATCAACAAGAATGT
rJMSF020E21- CAAAGCAATCCAGATAATCATCCTGAACTTGAAAATAGATTCCCATATCAACAAGAATGT
rJMSF019E21- CAAAGCAATCCAGATAATCATCCTGAACTTGAAAATAGATTCCCATATCAACAAGAATGT
rJMFF020F17- CAAAGCAATCCAGATAATCATCCTGAACTTGAAAATAGATTCCCATATCAACAAGAATGT
                      ____________________________________________________________
consensus CAAAGCAATCCAGATAATCATCCTGAACTTGAAAATAGATTCCCATATCAACAAGAATGT
 
. : . : . : . : . : . :
JMFN032N07+ CTTTCACACCAACATGCTTC
rJMFF009M20- CTTTCACACCAACATGCTTCTCAAGATCCTCACCAGCCATAAGAAGTGCACATGCCACCG
rJMFF034J21- CTTTCACACCAACATGCTTCTCAAGATCCTCACCAGCCATAAGAAGTGCACATGCCACCG
rJMFF006H08- CTTTCACACCAACATGCTTCTCAAGATCCTCACCAGCCATAAGAAGTGCACATGCCACCG
rJMSF049J08- CTTTCACACCAACATGCTTCTCAAGATCCTCACCAGCCATAAGAAGTGCACATGCCACCG
rJMSF020E21- CTTTCACACCAACATGCTTCTCAAGATCCTCACCAGCCATAAGAAGTGCACATGCCACCG
rJMSF019E21- CTTTCACACCAACATGCTTCTCAAGATCCTCACCAGCCATAAGAAGTGCACATGCCACCG
rJMFF020F17- CTTTCACACCAACATGCTTCTCAAGATCCTCACCAGCCATAAGAAGTGCACATGCCACCG
JMSF049J08+ ACCAGCCATAAGAAGTGCACATGCCACCG
                      ____________________________________________________________
consensus CTTTCACACCAACATGCTTCTCAAGATCCTCACCAGCCATAAGAAGTGCACATGCCACCG
 
. : . : . : . : . : . :
rJMFF009M20- GGAGGTAAAATGAATAGTAAGCAGTCTTGTATTCGACA
rJMFF034J21- GGAGGTAAAATGAATAGTAAGCAGTCTTGTATTCGACAA
rJMFF006H08- GGAGGTAAAATGAATAGTAAGCAGTCTTGTATTCGACAATACGGCGGTGGAGAGACAATG
rJMSF049J08- GGAGGTAAAATGAATAGTAAGCAGTCTTGTATTCGACAATACGGCGGTGGAGAGACAATG
rJMSF020E21- GGAGGTAAAATGAATAGTAAGCAGTCNTGTATTCGACAATACGGCGGTGGAGAGACAATG
rJMSF019E21- GGAGGTAAAATGAATAGTAAGCAGTCTTGTATTCGACAATACGGCGGTGGAGAGACAATG
rJMFF020F17- GGAGGTAAAATGAATAGTAAGCAGTCTTGTATTCGACAATACGGCGGTGGAGAGACAATG
JMFN033D09+ GAGAGACAATG
JMFN003G17+ GGAGAGACAATG
JMFF006H08+ CGACAATACGGCGGTGGAGAGACAATG
JMSF049J08+ GGAGGTAAAATGAATAGTAAGCAGTCTTGTATTCGACAATACGGCGGTGGAGAGACAATG
JMFF051P01+ AGAGACAATG
                      ____________________________________________________________
consensus GGAGGTAAAATGAATAGTAAGCAGTCTTGTATTCGACAATACGGCGGTGGAGAGACAATG
 
. : . : . : . : . : . :
rJMFF006H08- AATATTTTGACAGATCTTTTT-CCCCGACAAGGGTGGTAATCAGATCAATCATTTGCCCA
rJMSF049J08- AATATTTTGACAGATCTTTTT-CCCCGACAAGGGTGGTAATCAGATCAATCATTTGCCCA
rJMSF020E21- AATATTTTGACAGATCTTTTTCCCCCGACANGGGTGGTAATCAG
rJMSF019E21- AATATTTTGACAGATCTTTTT-CCCCGACAAGGGTGGTAATCAGATCAATCATTTGCCCA
rJMFF020F17- AATATTTTGACAGATCTTTTT-CCCCGACAAGGGTGGTAATCAGATCAATCATTTGCCCA
JMFN033D09+ AATATTTTGACAGATCTTTTT-CCCCGACAAGGGTGGTAATCAGATCAATCATTTGCCCA
JMFN003G17+ AATATTTTGACAGATCTTTTT-CCCCGACAAGGGTGGTAATCAGATCAATCATTTGCCCA
JMFF006H08+ AATATTTTGACAGATCTTTTT-CCCCGACAAGGGTGGTAATCAGATCAATCATTTGCCCA
JMSF049J08+ AATATTTTGACAGATCTTTTT-CCCCGACAAGGGTGGTAATCAGATCAATCATTTGCCCA
JMFF009M20+ CCCGACAAGGGTGGTAATCAGATCAATCATTTGCCCA
JMFF051P01+ AATA-TTTGACAGATCTNTTT-CCCCGACAAGGGTGGTAATCAGATCAATCATTTGCNCA
JMFF020F17+ CGACAAGGGTGGTAATCAGATCAATCATTTGCCCA
JMFF034J21+ GGGTGGTAATCAGATCAATCATTTGCCCA
                      ____________________________________________________________
consensus AATATTTTGACAGATCTTTTT-CCCCGACAAGGGTGGTAATCAGATCAATCATTTGCCCA
 
. : . : . : . : . : . :
rJMFF006H08- CTGGCAGTTTGGAATTCCACCTCATTAAACAGATCCCACAGATCAACATAATAAGGCTT
rJMSF049J08- CTGGCAGTTTGGAATTC
rJMSF019E21- CTGGCAGTTTGGAATTCCACCTCATTAAACAGATCCACCAGATCAACATAATAAGGCTTT
rJMFF020F17- CTGGCAGTTTGGAATTCCACCTCATTAAACAGATCCCACAGATCAACATAATAAGGCTTT
JMFN033D09+ CTGGCAGTTTGGAATTCCACCTCATTAAACAGATCCAACAGATCAACATAATAAGGCTTT
JMFN003G17+ CTGGCAGTTTGGAATTCCACCTCATTAAACAGATCCAACAGATCAACATAATAAGGCTTT
JMFF006H08+ CTGGCAGTTTGGAATTCCACCTCATTAAACAGATCCAACAGATCAACATAATAAGGCTTT
JMSF049J08+ CTGGCAGTTTGGAATTCCACCTCATTAAACAGATCCAACAGATCAACATAATAAGGCTTT
JMFF009M20+ CTGGCAGTTTGGAATTCCACCTCATTAAACAGATCCAACAGATCAACATAATAAGGCTTT
JMFF051P01+ CTGGCAG-TTGGAATTCCACCTCATTAAACAGATCCAACAGATCAACATAATAAGGCTTT
JMFF020F17+ CTGGCAGTTTGGAATTCCACCTCATTAAACAGATCCAACAGATCAACATAATAAGGCTTT
JMFF034J21+ CTGGCAGTTTGGAATTCCACCTCATTAAACAGATCCAACAGATCAACATAATAAGGCTTT
                      ____________________________________________________________
consensus CTGGCAGTTTGGAATTCCACCTCATTAAACAGATCCAACAGATCAACATAATAAGGCTTT
 
. : . : . : . : . : . :
rJMSF019E21- CCTTTAA
rJMFF020F17- CCTTTAAAGTGATTCT
JMFN033D09+ CCTTTAAAGTGATTCTTGAGAATCCGTGCAATATGGTTGCGGAGAAGTATCGCATCATTT
JMFN003G17+ CCTTTAAAGTGATTCTTGAGAATCCGTGCAATATGGTTGCGGAGAAGTATCGCATCATTT
JMFF006H08+ CCTTTAAAGTGATTCTTGAGAATCCGTGCAATATGGTTGCGGAGAAGTATCGCATCATTT
JMSF049J08+ CCTTTAAAGTGATTCTTGAGAATCCGTGCAATATGGTTGCGGAGAAGTATCGCATCATTT
JMFF009M20+ CCTTTAAAGTGATTCTTGAGAATCCGTGCAATATGGTTGCGGAGAAGTATCGCATCATTT
JMFF051P01+ CCTTTAAAGTGATTCTTGAGAATCCGTGCAATATGGTTGCGGAGAAGTATCGCATCATTT
JMFF020F17+ CCTTTAAAGTGATTCTTGAGAATCCGTGCAATATGGTTGCGGAGAAGTATCGCATCATTT
JMFF034J21+ CCTTTAAAGTGATTCTTGAGAATCCGTGCAATATGGTTGCGGAGAAGTATCGCATCATTT
                      ____________________________________________________________
consensus CCTTTAAAGTGATTCTTGAGAATCCGTGCAATATGGTTGCGGAGAAGTATCGCATCATTT
 
. : . : . : . : . : . :
JMFN033D09+ GCAGCAATCAATCCAATCTTAGGCTGCCTGAACCAACATGGTTGGCCTCTCCGCGTATGA
JMFN003G17+ GCAGCAATCAATCCAATCTTAGGCTGCCTGAACCAACATGGTTGGCCTCTCCGCGTATGA
JMFF006H08+ GCAGCAATCAATCCAATCTTAGGCTGCCTGAACCAACATGGTTGGCCTCTCCGCGTATGA
JMSF049J08+ GCAGCAATCAATCCAATCTTAGGCTGCCTGAACCAACATGGTTGGCCTCTCCGCGTATGA
JMFF009M20+ GCAGCAATCAATCCAATCTTAGGCTGCCTGAACCAACATGGTTGGCCTCTCCGCGTATGA
JMFF051P01+ GCAGCAATCAATCCAATCTTAGGCTGCCTGAACCAACATGGTTGGCCTCTCCGCGTATGA
JMFF020F17+ GCAGCAATCAATCCAATCTTAGGCTGCCTGAACCAACATGGTTGGCCTCTCCGCGTATGA
JMFF034J21+ GCAGCAATCAATCCAATCTTAGGCTGCCTGAACCAACATGGTTGGCCTCTCCGCGTATGA
                      ____________________________________________________________
consensus GCAGCAATCAATCCAATCTTAGGCTGCCTGAACCAACATGGTTGGCCTCTCCGCGTATGA
 
. : . : . : . : . : . :
JMFN033D09+ GAGCCATCCATTATGTCATCAAGAACCAGGAAGTATGCTTGAAGCCATTCAATACACCAG
JMFN003G17+ GAGCCATCCATTATGTCATCAAGAACCAGGAAGTATGCTTGAAGCCATTCAATACACCAG
JMFF006H08+ GAGCCATCCATTATGTCATCAAGAACCAGGAAGTATGCTTGAAGCCATTCAATACACCAG
JMSF049J08+ GAGCCATCCATTATGTCATCAAGAACCAGGAAGTATGCTTGAAGCCATTCAATACACCAG
JMFF009M20+ GAGCCATCCATTATGTCATCAAGAACCAGGAAGTATGCTTGAAGCCATTCAATACACCAG
JMFF051P01+ GAGCCATCCATTATGTCATCAAGAACCAGGAAGTATGCTTGAAGCCATTCAATACACCAG
JMFF020F17+ GAGCCATCCATTATGTCATCAAGAACCAGGAAGTATGCTTGAAGCCATTCAATACACCAG
JMFF034J21+ GAGCCATCCATTATGTCATCAAGAACCAGGAAGTATGCTTGAAGCCATTCAATACACCAG
                      ____________________________________________________________
consensus GAGCCATCCATTATGTCATCAAGAACCAGGAAGTATGCTTGAAGCCATTCAATACACCAG
 
. : . : . : . : . : . :
JMFN033D09+ CCAAGAGCAGACGTAAGAAATATTTCATCATCGGTTAGTTCTTCCCCCTCTTTCAGCAGC
JMFN003G17+ CCAAGAGCAGACGTAAGAAATATTTCATCATCGGTTAGTTCTTCCCCCTCTTTCAGCAGC
JMFF006H08+ CCAAGAGCAGACGTAAGAAATATTTCATCATCGGTTAGTTCTTCCCCCTCTTTCAGCAGC
JMSF049J08+ CCAAGAGCAGACGTAAGAAATATTTCATCATCGGTTAGTTCTTCCCCCTCTTTCAGCAGC
JMFF009M20+ CCAAGAGCAGACGTAAGAAATATTTCATCATCGGTTAGTTCTTCCCCCTCTTTCAGCAGC
JMFF051P01+ CCAAGAGCAGACGTAAGAAATATTTCATCATCGGTTAGTTCTTCCCCCTCTTTCAGCAGC
JMFF020F17+ CCAAGAGCAGACGTAAGAAATATTTCATCATCGGTTAGTTCTTCCCCCTCTTTCAGCAGC
JMFF034J21+ CCAAGAGCAGACGTAAGAAATATTTCATCATCGGTTAGTTCTTCCCCCTCTTTCAGCAGC
JMSF019E21+ TTCAGCAGC
                      ____________________________________________________________
consensus CCAAGAGCAGACGTAAGAAATATTTCATCATCGGTTAGTTCTTCCCCCTCTTTCAGCAGC
 
. : . : . : . : . : . :
JMFN033D09+ TTGTAGCTATCAATAACAGAGAGCCCTCTGTTCAACTTCCCTCCAGGCACATTGTAGTCC
JMFN003G17+ TTGTAGCTATCAATAACAGAGAGCCCTCTGTTCAACTTCCCTCCAGGCACATTGTAGTCC
JMFF006H08+ TTGTAGCTATCAATAACAGAGAGCCCTCTGTTCAACTTCCCTCCAGGCACATTGTAGTCC
JMSF049J08+ TTGTAGCTATCAATAACAGAGAGCCCTCTGTTCAACTTCCCTCCAGGCACATTGTAGTCC
JMFF009M20+ TTGTAGCTATCAATAACAGAGAGCCCTCTGTTCAACTTCCCTCCAGGCACATTGTAGTCC
JMFF051P01+ TTGTAGCTATCAATAACAGAGAGCCCTCTGTTCAACTTCCCTCCAGGCACATTGTAGTCC
JMFF020F17+ TTGTAGCTATCAATAACAGAGAGCCCTCTGTTCAACTTCCCTCCAGGCACATTGTAGTCC
JMFF034J21+ TTGTAGCTATCAATAACAGAGAGCCCTCTGTTCAACTTCCCTCCAGGCACATTGTAGTCC
JMSF019E21+ TNGTAGCTATCAATAACAGAGAGCCCTCTGTTCAACTTCCCTCCAGGCACATTGTAGTCC
                      ____________________________________________________________
consensus TTGTAGCTATCAATAACAGAGAGCCCTCTGTTCAACTTCCCTCCAGGCACATTGTAGTCC
 
. : . : . : . : . : . :
JMFN033D09+ AGCATCCGCTCAACCCACTGACGAGAATCATCGGTCCACTCGAAAGCAGGGTCATTGAGG
JMFN003G17+ AGCATCCGCTCAACCCACTGACGAGAATCATCGGTCCACTCGAAAGCAGGGTCATTGAGG
JMFF006H08+ AGCATCCGCTCAACCCACTGACGAGAATCATCGGTCCACTCGAAAGCAGGGTCATTGAGG
JMSF049J08+ AGCATCCGCTCAACCCACTGACGAGAATCATCGGTCCACTCGAAAGCAGGGTCATTGAGG
JMFF009M20+ AGCATCCGCTCAACCCACTGACGAGAATCATCGGTCCACTCGAAAGCAGGGTCATTGAGG
JMFF051P01+ AGCATCCGCTCAACCCACTGACGAGAATCATCGGT--ACTCGAAAGCAGGGTCATTGAGG
JMFF020F17+ AGCATCCGCTCAACCCACTGACGAGAATCATCGGT--ACTCGAAAGCAGGGTCATTGAGG
JMFF034J21+ AGCATCCGCTCAACCCACTGACGAGAATCATCGGTCCACTCGAAAGCAGGGTCATTGAGG
JMSF019E21+ AGCATCCGCTCAACCCACTGACGAGAATCATCGGTCCACTCGAAAGCAGGGTCATTGAGG
                      ____________________________________________________________
consensus AGCATCCGCTCAACCCACTGACGAGAATCATCGGTCCACTCGAAAGCAGGGTCATTGAGG
 
. : . : . : . : . : . :
JMFN033D09+ AGCTCGGACTTGAGGGTGGAGTAGACCTCGAGAAACTTGGCCTTAAGATCGCTCATTGCT
JMFN003G17+ AGCTCGGACTTGAGGGTGGAGTAGACCTCGAGAAACTTGGCCTTAAGATCGCTCATTGCT
JMFF006H08+ AGCTCGGACTTGAGGGTGGAGTAGACCTCGAGAAACTTGGCCTTAAGATCGCTCATTGCT
JMSF049J08+ AGCTCGGACTTGAGGGTGGAGTAGACCTCGAGAAACTTGGCCTTAAGATCGCTCATTGCT
JMFF009M20+ AGCTCGGACTTGAGGGTGGAGTAGACCTCGAGAAACTTGGCCTTAAGATCGCTCATTGCT
JMFF051P01+ AGCTCGGACTTGAGGGTGGAGTAGACCTCGAGAAACTTGGCCTTAAGATCGCTCATTGCT
JMFF020F17+ AGCTCGGACTTGAGGGTGGAGTAGACCTCGAGAAACTTGGCCTTAAGATCGCTCATTGCT
JMFF034J21+ AGCTCGGACTTGAGGGTGGAGTAGACCTCGAGAAACTTGGCCTTAAGATCGCTCATTGCT
JMSF019E21+ AGCTCGGACTTGAGGGTGGAGTAGACCTCGAGAAACTTGGCCTTAAGATCGCTCATTGCT
                      ____________________________________________________________
consensus AGCTCGGACTTGAGGGTGGAGTAGACCTCGAGAAACTTGGCCTTAAGATCGCTCATTGCT
 
. : . : . : . : . : . :
JMFN033D09+ GTAGAGAGAGAAACAAGAAATGGAGAGAGAAAGTGTTCG
JMFN003G17+ GTAGAGAGAGAAACAAGAAATGGAGAGAGAAAGTGT
JMFF006H08+ GTAGAGAGAGAAACAAGAAATGGAGAGAGAAAGTGTTCGTTAGTTTCAGAGTCTTT
JMSF049J08+ GTAGAGAGAGAAACAAGAAATGGAGAGAGAAAGTGTTCGTTAGTTTCAGAGTCTTT
JMFF009M20+ GTAGAGAGAGAAACAAGAAATGGAGAGAGAAAGTGTTCGTTAGTTTCAGAGTCTTT
JMFF051P01+ GTAGAGAGAGAAACAAGAAATGGAGAGAGAAAGTGTTCGTTAGTTTCAGAGTCTTT
JMFF020F17+ GTAGAGAGAGAAACAAGAAATGGAGAGAGAAAGTGTTCGTTAGTTTCAGAGTCTTT
JMFF034J21+ GTAGAGAGAGAAACAAGAAATGGAGAGAGAAAGTGTTCGTTAGTTTCAGAGTCTTT
JMSF019E21+ GTAGAGAGAGAAACAAGAAATGGAGAGAGAAAGTGTTCGTTAGTTTCAGAGTCTTTGGTC
                      ____________________________________________________________
consensus GTAGAGAGAGAAACAAGAAATGGAGAGAGAAAGTGTTCGTTAGTTTCAGAGTCTTTGGTC