Previous Contig 005812:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF019E13Sequence516005812 (4)gb:AY133578_15814013e-09Arabidopsis thaliana At4g30240/F9N11_90 mRNA, complete cds.>gb:AF428456_1799386 732022863pir|T14084|T140841e-04hypothetical protein F9N11.90 - Arabidopsis thaliana>gb:ATCHRIV72_1546945 Arabid
JMSF031N14Sequence620005812 (4)gb:AY133578_15814014e-34Arabidopsis thaliana At4g30240/F9N11_90 mRNA, complete cds.>gb:AF428456_1799386 201023495
JMSF039F12Sequence604005812 (4)gb:AY133578_15814014e-34Arabidopsis thaliana At4g30240/F9N11_90 mRNA, complete cds.>gb:AF428456_1799386
JMSF050N07Sequence680005812 (4)gb:AY133578_15814015e-34Arabidopsis thaliana At4g30240/F9N11_90 mRNA, complete cds.>gb:AF428456_1799386

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039F12+ TAGGATTCTCGTAAGGCTGCTTCAACACGGGAAAT
JMSF031N14+ TAGGATTCTCGTAAGGCTGCTTCAACACGGGAAAT
JMSF050N07+ CCTTCAATGTTGTAGGATTCTCGTAAGGCTGCTTCAACACGGGAAAT
                      ____________________________________________________________
consensus CCTTCAATGTTGTAGGATTCTCGTAAGGCTGCTTCAACACGGGAAAT
 
. : . : . : . : . : . :
JMSF039F12+ CTGAGCTTCCATTGCAGAAACAAAGTTTCTATGCCTGGTCATCGTAATCTCGTCAGCACG
JMSF031N14+ TTGAGCTTCCATTGCAGAAACAAAGTTTCTATGCCTGGTCATCGTAATCTCGTCAGCACG
JMSF050N07+ TTGAGCTTCCATTGCAGAAACAAAGTTTCTATGCCTGGTCATCGTAATCTCGTCAGCACG
                      ____________________________________________________________
consensus TTGAGCTTCCATTGCAGAAACAAAGTTTCTATGCCTGGTCATCGTAATCTCGTCAGCACG
 
. : . : . : . : . : . :
JMSF039F12+ ATTTCTGTAGCTCAGCCTAACCGCCTTCTCAAACTCATCCAGCTGCCATTTTGCTGTGCC
JMSF031N14+ ATTTCTGTAGCTCAGCCTAACCGCCTTCTCAAACTCATCCAGCTGCCATTTTGCTGTGCC
JMSF050N07+ ATTTCTGTAGCTCAGCCTAACCGCCTTCTCAAACTCATCCAGCTGCCATTTTGCTGTGCC
                      ____________________________________________________________
consensus ATTTCTGTAGCTCAGCCTAACCGCCTTCTCAAACTCATCCAGCTGCCATTTTGCTGTGCC
 
. : . : . : . : . : . :
JMSF039F12+ TAAAGCCATCTGAAGCTCTCCCCGGAGCTCATCTATAAACTGAGGTGCTACCCCTTCTCT
JMSF031N14+ TAAAGCCATCTGAAGCTCTCCCCGGAGCTCATCTATAAACTGAGGTGCTACCCCTTCTCT
JMSF050N07+ TAAAGCCATCTGAAGCTCTCCCCGGAGCTCATCTATAAACTGAGGTGCTACCCCTTCTCT
                      ____________________________________________________________
consensus TAAAGCCATCTGAAGCTCTCCCCGGAGCTCATCTATAAACTGAGGTGCTACCCCTTCTCT
 
. : . : . : . : . : . :
JMSF039F12+ CCTCTCTCTTACCCAGGTCCTATAAGCTGATTCCATTATATCGGCAGATTTCTGAACCTC
JMSF031N14+ CCTCTCTCTTACCCAGGTCCTATAAGCTGATTCCATTATATCGGCAGATTTCTGAACCTC
JMSF050N07+ CCTCTCTCTTACCCAGGTCCTATAAGCTGATTCCATTATATCGGCAGATTTCTGAACCTC
JMSF019E13+ TTACCCAGGTCNTATAAGNTGATTCCATTATATCGGCAGATTTNTGAACCTC
                      ____________________________________________________________
consensus CCTCTCTCTTACCCAGGTCCTATAAGCTGATTCCATTATATCGGCAGATTTCTGAACCTC
 
. : . : . : . : . : . :
JMSF039F12+ CTCGGCAGCGGAGAAGAAGATGTCCTTCTGCCATAAGTCAAAACTGTTGGCGACCAGCAT
JMSF031N14+ CTCGGCAGCGGAGAAGAAGATGTCCTTCTGCCATAAGTCAAAACTGTTGGCGACCAGCAT
JMSF050N07+ CTCGGCAGCGGAGAAGAAGATGTCCTTCTGCCATAAGTCAAAACTGTTGGCGACCAGCAT
JMSF019E13+ CTCGGCAGCGGAGAAGAAGATGTCCTTNTGCCATAAGTCAAAACTGTTGGCGACCAGCAT
                      ____________________________________________________________
consensus CTCGGCAGCGGAGAAGAAGATGTCCTTCTGCCATAAGTCAAAACTGTTGGCGACCAGCAT
 
. : . : . : . : . : . :
JMSF039F12+ CTTTGCTTCTCTCGTCTCCCCAATTCAACAAATTGGCCACCGCCGATTCAAAATCAAATT
JMSF031N14+ CTTTGCTTCTCTCGTCTCCCCAATTCAACAAATTGGCCACCGCCGATTCAAAATCAAATT
JMSF050N07+ CTTTGCTTCTCTCGTCTCCCCAATTCAACAAATTGGCCACCGCCGATTCAAAATCAAATT
JMSF019E13+ CTTTGCTTCTCTCGTCTCCCCAATTCAACAAATTGGCCACCGCCGATTCAAAATCAAATT
                      ____________________________________________________________
consensus CTTTGCTTCTCTCGTCTCCCCAATTCAACAAATTGGCCACCGCCGATTCAAAATCAAATT
 
. : . : . : . : . : . :
JMSF039F12+ CCTGTGTATATATAATAATAATACGGGAAAAGAGAGGATTGAGATGCGCACAAGTTAGCT
JMSF031N14+ CCTGTGTATATATAATAATAATACGGGAAAAGAGAGGATTGAGATGCGCACAAGTTAGCT
JMSF050N07+ CCTGTGTATATATAATAATAATACGGGAAAAGAGAGGATTGAGATGCGCACAAGTTAGCT
JMSF019E13+ CCTGTGTATATATAATAATAATACGGGAAAAGAGAGGATTGAGATGCGCACAAGTTAGCT
                      ____________________________________________________________
consensus CCTGTGTATATATAATAATAATACGGGAAAAGAGAGGATTGAGATGCGCACAAGTTAGCT
 
. : . : . : . : . : . :
JMSF039F12+ AAATCCTGGTCGGTGTTGTCTTCTCTTCTTTGCTGAGAAGGCGAAGCAAAGAAGGAAGAG
JMSF031N14+ AAATCCTGGTCGGTGTTGTCTTCTCTTCTTTGCTGAGAAGGCGAAGCAAAGAAGGAAGAG
JMSF050N07+ AAATCCTGGTCGGTGTTGTCTTCTCTTCTTTGCTGAGAAGGCGAAGCAAAGAAGGAAGAG
JMSF019E13+ AAATCCTGGTCGGTGTTGTCTTCTCTTCTTTGCTGAGAAGGCGAAGCAAAGAAGGAAGAG
                      ____________________________________________________________
consensus AAATCCTGGTCGGTGTTGTCTTCTCTTCTTTGCTGAGAAGGCGAAGCAAAGAAGGAAGAG
 
. : . : . : . : . : . :
JMSF039F12+ AGAGAAAGAAAGCACAGAAACAGAGAGAGAGAAAGAGACGTATGAGCGAATCTCTTCCCC
JMSF031N14+ AGAGAAAGAAAGCACAGAAACAGAGAGAGAGAAAGAGACGTATGAGCGAATCTCTTCCCC
JMSF050N07+ AGAGAAAGAAAGCACAGAAACAGAGAGAGAGAAAGAGACGTATGAGCGAATCTCTTCCCC
JMSF019E13+ AGAGAAAGAAAGCACAGAAACAGAGAGAGAGAAAGAGACGTATGAGCGAATCTCTTCCCC
                      ____________________________________________________________
consensus AGAGAAAGAAAGCACAGAAACAGAGAGAGAGAAAGAGACGTATGAGCGAATCTCTTCCCC
 
. : . : . : . : . : . :
JMSF039F12+ CTTCCCTCTCCCCTCTTCTTCTGTCTTT
JMSF031N14+ CTTCCCTCTCCCCTCTTCTTCTGTCTTTGCTTTTTCTCTATTCTC
JMSF050N07+ CTTCCCTCTCCCCTCTTCTTCTGTCTTTGCTTTTTCTCTATTCTCTCTCCCCCTAGTATT
JMSF019E13+ CTTCCCTCTCCCCTCTTCTTCTGTCTTTGCTTTTTCTCTATTCTCTCTCCCCCTAGTATT
                      ____________________________________________________________
consensus CTTCCCTCTCCCCTCTTCTTCTGTCTTTGCTTTTTCTCTATTCTCTCTCCCCCTAGTATT
 
. : . : . : . : . : . :
JMSF050N07+ TGGGTCCGTTTATAGTTGGGAATTTTTCCTC
JMSF019E13+ TGGGTCCGTTTATAGTTGGGAATTTTTCCTCATTTTACCAAACAACTCGCGCCTGTCTTC
                      ____________________________________________________________
consensus TGGGTCCGTTTATAGTTGGGAATTTTTCCTCATTTTACCAAACAACTCGCGCCTGTCTTC