Previous Contig 005803:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF040B24Sequence804005803 (7)gb:AP005871_18593939e-10Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B111
JMFN033L21Sequence616005803 (7)pir|T47832|T478326e-27hypothetical protein T2O9.60 - Arabidopsis thaliana>gb:ATT2O9_1555758 Arabidopsi
JMFS071D03Sequence625005803 (7)pir|T47832|T478326e-27hypothetical protein T2O9.60 - Arabidopsis thaliana>gb:ATT2O9_1555758 Arabidopsi
JMSF019D04Sequence339005803 (7)pir|T47832|T478326e-06hypothetical protein T2O9.60 - Arabidopsis thaliana>gb:ATT2O9_1555758 Arabidopsi797005803 (7)gb:AK118283_18162701e-10Arabidopsis thaliana At3g19950 mRNA for unknown protein, complete cds, clone: RA
JMSF032N09Sequence652005803 (7)pir|T47832|T478322e-29hypothetical protein T2O9.60 - Arabidopsis thaliana>gb:ATT2O9_1555758 Arabidopsi699005803 (7)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032N09- ACCAAATTCGTC-AGACAGAC
rJMSF019D04- ACCAAATTCGTC-AGACAGAC
rJMFF040B24- TTATAACCAAATTCGTCAAGACAGAC
                      ____________________________________________________________
consensus TTATAACCAAATTCGTC-AGACAGAC
 
. : . : . : . : . : . :
rJMSF032N09- GATTATACAAGTCACTTACAGCCTAAAGAAACTCACAAACCAGCCTTCACATGCAGAAGC
rJMSF019D04- GATTATACAAGTCACTTACAGCCTAAAGAAACTCACAAACCAGCCTTCACATGCAGAAGC
rJMFF040B24- GATTATACAAGTCACTTACAGCCTAAAGAAACTCACAAACCAGCCTTCACATGCAGAAGC
                      ____________________________________________________________
consensus GATTATACAAGTCACTTACAGCCTAAAGAAACTCACAAACCAGCCTTCACATGCAGAAGC
 
. : . : . : . : . : . :
rJMSF032N09- AAGGGCAAGGGTAGGGGTTTGGGAAGAAGGGGGGATGGGGAATGGATTTTAATGTTTATG
rJMSF019D04- AAGGGCAAGGGTAGGGGTTTGGGAAGAAGGGGGGATGGGGAATGGATTTTAATGTTTATG
rJMFF040B24- AAGGGCAAGGGTAGGGGTTTGGGAAGAAGGGGGGATGGGGAATGGATTTTAATGTTTATG
                      ____________________________________________________________
consensus AAGGGCAAGGGTAGGGGTTTGGGAAGAAGGGGGGATGGGGAATGGATTTTAATGTTTATG
 
. : . : . : . : . : . :
rJMSF032N09- CTTCAGAAATTTTTACAAATATGAAACATCCATGCTAGATCTACAATTCGTCAGATGCGC
rJMSF019D04- CTTCAGAAATTTTTACAAATATGAAACATCCATGCTAGATCTACAATTCGTCAGATGCGC
rJMFF040B24- CTTCAGAAATTTTTACAAATATGAAACATCCATGCTAGATCTACAATTCGTCAGATGCGC
                      ____________________________________________________________
consensus CTTCAGAAATTTTTACAAATATGAAACATCCATGCTAGATCTACAATTCGTCAGATGCGC
 
. : . : . : . : . : . :
rJMSF032N09- AGGTTGAACTTTATTCCTTCTAACAAGTCCTAATCGCAGCAATACTCCATCTTATTTCTC
rJMSF019D04- AGGTTGAACTTTATTCCTTCTAACAAGTCCTAATCGCAGCAATACTCCATCTTATTTCTC
rJMFF040B24- AGGTTGAACTTTATTCCTTCTAACAAGTCCTAATCGCAGCAATACTCCATCTTATTTCTC
                      ____________________________________________________________
consensus AGGTTGAACTTTATTCCTTCTAACAAGTCCTAATCGCAGCAATACTCCATCTTATTTCTC
 
. : . : . : . : . : . :
rJMSF032N09- TTGAGAACGAAAGGGATCTTCTGGCCAACTTCAATTCAAGACCTCACCGCAGCATCTCCT
rJMSF019D04- TTGAGAACGAAAGGGATCTTCTGGCCAACTTCAATTCAAGACCTCACCGCAGCATCTCCT
rJMFF040B24- TTGAGAACGAAAGGGATCTTCTGGCCAACTTCAATTCAAGACCTCACCGCAGCATCTCCT
                      ____________________________________________________________
consensus TTGAGAACGAAAGGGATCTTCTGGCCAACTTCAATTCAAGACCTCACCGCAGCATCTCCT
 
. : . : . : . : . : . :
rJMSF032N09- TCACCCAACCTACTGCTGCTAACACCAACTTCCCCTTCACAGGCACTATCCCCTGGGCAG
rJMSF019D04- TCACCCGACCTACTGCTGCTAACACCAACTTCCCCTTCACAGGCACTATCCCCTGGGCAG
rJMFF040B24- TCACCCAACCTACTGCTGCTAACACCAACTTCCCCTTCACAGGCACTATCCCCTGGGCAG
                      ____________________________________________________________
consensus TCACCCAACCTACTGCTGCTAACACCAACTTCCCCTTCACAGGCACTATCCCCTGGGCAG
 
. : . : . : . : . : . :
rJMSF032N09- CATGGCAAACTCGAAACAGTCTCCACACTAGTAGCCCTCCTGGCAACCCCAACTCCAAGA
rJMSF019D04- CATGGCAAACTCGAAACAGTCTCCACACTAGTAGCCCTCCTGGCAACCCCAACTCCAAGA
rJMFF040B24- CATGGCAAACTCGAAACAGTCTCCACACTAGTAGCCCTCCTGGCAACCCCAACTCCAAGA
                      ____________________________________________________________
consensus CATGGCAAACTCGAAACAGTCTCCACACTAGTAGCCCTCCTGGCAACCCCAACTCCAAGA
 
. : . : . : . : . : . :
rJMSF032N09- CCAGCTTCCCCAATTTGTGTAGGAGAAAGCAAAAAGACTTCACTGGTGCCATGACTGCCA
rJMSF019D04- CCAGCTTCCCCAATTTGTGTAGGAGAAAGCAAAAAGACTTCACTGGTGCCATGACTGCCA
rJMFF040B24- CCAGCTTCCCCAATTTGTGTAGGAGAAAGCAAAAAGACTTCACTGGTGCCATGACTGCCA
                      ____________________________________________________________
consensus CCAGCTTCCCCAATTTGTGTAGGAGAAAGCAAAAAGACTTCACTGGTGCCATGACTGCCA
 
. : . : . : . : . : . :
rJMSF032N09- TTGCTTTCAATTACAGTCTGATGCCTTCGTCCAATATGTATAAGGGCTTCAACCTCACTC
rJMSF019D04- TTGCTTTCAATTACAGTCTGATGCCTTCGTCCAATATGTATAAGGGCTTCAACCTCACTC
rJMFF040B24- TTGCTTTCAATTACAGTCTGATGCCTTCGTCCAATATGTATAAGGGCTTCAACCTCACTC
                      ____________________________________________________________
consensus TTGCTTTCAATTACAGTCTGATGCCTTCGTCCAATATGTATAAGGGCTTCAACCTCACTC
 
. : . : . : . : . : . :
rJMSF032N09- CTAGCAATACGTCTGATAGCACTCTGAAAACCAAAAAGCTCCTCATCATCATCCATCAAT
rJMSF019D04- CTAGCAATACGTCTGATAGCACTCTGAAAACCAAAAAGCTCCTCATCATCATCCATCAAT
rJMFF040B24- CTAGCAATACGTCTGATAGCACTCTGAAAACCAAAAAGCTCCTCATCATCATCCATCAAT
                      ____________________________________________________________
consensus CTAGCAATACGTCTGATAGCACTCTGAAAACCAAAAAGCTCCTCATCATCATCCATCAAT
 
. : . : . : . : . : . :
rJMSF032N09- TCTTCGAGTCTCATTGCTCCTACGAAATTATCCCCCCTGGGCAAAGTCTCGACCTCGGAG
rJMSF019D04- TCTTCGAGTCTCATTGCTCCTACGAAATTATCCCCCCTGGGCAAAGTCTCGACCTCGGAG
rJMFF040B24- TCTTCGAGTCTCATTGCTCCTACGAAATTATCCCCCCTGGGCAAAGTCTCGACCTCGGAG
                      ____________________________________________________________
consensus TCTTCGAGTCTCATTGCTCCTACGAAATTATCCCCCCTGGGCAAAGTCTCGACCTCGGAG
 
. : . : . : . : . : . :
rJMSF032N09- TCCTCATCTTCCCGCGGA
rJMSF019D04- TCCTCATCTTCCCGCGGAGGAAGCCGGAACCGACAAACCGGACACGAGTTATTCATCTCC
rJMFF040B24- TCCTCATCTTCCCGCGGAGGAAGCCGGAACCGACAAACCGGACACGAGTTATTCATCTCC
                      ____________________________________________________________
consensus TCCTCATCTTCCCGCGGAGGAAGCCGGAACCGACAAACCGGACACGAGTTATTCATCTCC
 
. : . : . : . : . : . :
rJMSF019D04- AACCACGGCAAAATGCAATCGGAATGGTACATGTGCTTACAGGGCAACATTTTCAC
rJMFF040B24- NACCACNGCAAAATGCAATCGGAATGGTACATGTGCTTACAGGGCAACATTTTCACTT
JMFS071D03+ GGCAAAATGCAATCGGAATGGTACATGTGCTTACAGGGCAACATTTTCACTTCC
JMFN033L21+ GGCAAAATGCAATCGGAATGGTACATGTGCTTACAGGGCAACATTTTCACTTCC
JMSF032N09+ GGCAAAATGCAATCGGAATGGTACATGTGCTTACAGGGCAACATTTTCACTTCC
                      ____________________________________________________________
consensus AACCACGGCAAAATGCAATCGGAATGGTACATGTGCTTACAGGGCAACATTTTCACTTCC
 
. : . : . : . : . : . :
JMFS071D03+ AGGTTTAACACGAATAGGTCCTTGCAAATCGGGCAGGGTATAACCGGATCCTTGTCCAGA
JMFN033L21+ AGGTTTAACACGAATAGGTCCTTGCAAATCGGGCAGGGTATAACCGGATCCTTGTCCAGA
JMSF032N09+ AGGTTTAACACGAATAGGTCCTTGCAAATCGGGCAGGGTATAACCGGATCCTTGTCCAGA
                      ____________________________________________________________
consensus AGGTTTAACACGAATAGGTCCTTGCAAATCGGGCAGGGTATAACCGGATCCTTGTCCAGA
 
. : . : . : . : . : . :
JMFS071D03+ ATTGAAGAGTCAATTTGTAAGTCCTGTAGCGATTGTATAGCGGACTTTGAGGTAGGGTTG
JMFN033L21+ ATTGAAGAGTCAATTTGTAAGTCCTGTAGCGATTGTATAGCGGACTTTGAGGTAGGGTTG
JMSF032N09+ ATTGAAGAGTCAATTTGTAAGTCCTGTAGCGATTGTATAGCGGACTTTGAGGTAGGGTTG
                      ____________________________________________________________
consensus ATTGAAGAGTCAATTTGTAAGTCCTGTAGCGATTGTATAGCGGACTTTGAGGTAGGGTTG
 
. : . : . : . : . : . :
JMFS071D03+ TGGGGGCGATTGGCGGTGGTGAAGACGTCGTTGGTGGTGGTTAGATGGTGGACAAGGCGG
JMFN033L21+ TGGGGGCGATTGGCGGTGGTGAAGACGTCGTTGGTGGTGGTTAGATGGTGGACAAGGCGG
JMSF032N09+ TGGGGGCGATTGGCGGTGGTGAAGACGTCGTTGGTGGTGGTTAGATGGTGGACAAGGCGG
                      ____________________________________________________________
consensus TGGGGGCGATTGGCGGTGGTGAAGACGTCGTTGGTGGTGGTTAGATGGTGGACAAGGCGG
 
. : . : . : . : . : . :
JMFS071D03+ TGGAGATAAGGGCTGTCGAGGAGGAAGTTCTCGTCGGAGGGGACGAGGGTTGTACTAGGG
JMFN033L21+ TGGAGATAAGGGCTGTCGAGGAGGAAGTTCTCGTCGGAGGGGACGAGGGTTGTACTAGGG
JMSF032N09+ TGGAGATAAGGGCTGTCGAGGAGGAAGTTCTCGTCGGAGGGGACGAGGGTTGTACTAGGG
                      ____________________________________________________________
consensus TGGAGATAAGGGCTGTCGAGGAGGAAGTTCTCGTCGGAGGGGACGAGGGTTGTACTAGGG
 
. : . : . : . : . : . :
JMFS071D03+ TCCACGAACATGGGAGCTAAGCTAGGGCTAGTACCGAGGCTGTGTTGCGGGGGGAGAGGA
JMFN033L21+ TCCACGAACATGGGAGCTAAGCTAGGGCTAGTACCGAGGCTGTGTTGCGGGGGGAGAGGA
JMSF032N09+ TCCACGAACATGGGAGCTAAGCTAGGGCTAGTACCGAGGCTGTGTTGCGGGGGGAGAGGA
JMSF019D04+ GCTAGGGCTAGTACCGAGGCTNTGTTGC-GGGGGAGAGGA
                      ____________________________________________________________
consensus TCCACGAACATGGGAGCTAAGCTAGGGCTAGTACCGAGGCTGTGTTGCGGGGGGAGAGGA
 
. : . : . : . : . : . :
JMFS071D03+ GGAGGAGCAGGAGCAAAGGAGTCCATTTGCTCGAGGAAGTCGGAGTTGCAGTGAGGGCAA
JMFN033L21+ GGAGGAGCAGGAGCAAAGGAGTCCATTTGCTCGAGGAAGTCGGAGTTGCAGTGAGGGCAA
JMSF032N09+ GGAGGAGCAGGAGCAAAGGAGTCCATTTGCTCGAGGAAGTCGGAGTTGCAGTGAGGGCAA
JMSF019D04+ GGAGGAGCAGGAGCAAAGGAGTCCATTTGCTCGAGGAAGTCGGAGTTGCAGTGAGGGCAA
                      ____________________________________________________________
consensus GGAGGAGCAGGAGCAAAGGAGTCCATTTGCTCGAGGAAGTCGGAGTTGCAGTGAGGGCAA
 
. : . : . : . : . : . :
JMFS071D03+ CGCGCGGGGGAAGGCGTGGGAGGGCAGAGGAGGAAGACGCTCATGTCGCATTCGTGACAC
JMFN033L21+ CGCGCGGGGGAAGGCGTGGGAGGGCAGAGGAGGAAGACGCTCATGTCGCATTCGTGACAC
JMSF032N09+ CGCGCGGGGGAAGGCGTGGGAGGGCAGAGGAGGAAGACGCTCATGTCGCATTCGTGACAC
JMSF019D04+ CGCGCGGGGGAAGGCGTGGGAGGGCAGAGGAGGAAGACGCTCATGTCGCATTCGTGACAC
                      ____________________________________________________________
consensus CGCGCGGGGGAAGGCGTGGGAGGGCAGAGGAGGAAGACGCTCATGTCGCATTCGTGACAC
 
. : . : . : . : . : . :
JMFS071D03+ CAGTAAGTCTGGAGGTGATGCGGTTGCTGTTGATTCTGAGTAGTAGTAGCGGCGGCGGTG
JMFN033L21+ CAGTAAGTCTGGAGGTGATGCGGTTGCTGTTGATTCTGAGTAGTAGTAGCGGCGGCGGTG
JMSF032N09+ CAGTAAGTCTGGAGGTGATGCGGTTGCTGTTGATTCTGAGTAGTAGTAGCGGCGGCGGTG
JMSF019D04+ CAGTAAGTCTGGAGGTGATGCGGTTGCTGTTGATTCTGAGTAGTAGTAGCGGCGGCGGTG
                      ____________________________________________________________
consensus CAGTAAGTCTGGAGGTGATGCGGTTGCTGTTGATTCTGAGTAGTAGTAGCGGCGGCGGTG
 
. : . : . : . : . : . :
JMFS071D03+ GTTGTTGCGACGTCGGCGGAAGTGGCGGCGGTTGAAGCCATGGCGGTGGAGGAGCCGCGG
JMFN033L21+ GTTGTTGCGACGTCGGCGGAAGTGGCGGCGGTTGAAGCCATGGCGGTGGAGGAGCCGCGG
JMSF032N09+ GTTGTTGCGACGTCGGCGGAAGTGGCGGCGGTTGAAGCCATGGCGGTGGAGGAGCCGCGG
JMSF019D04+ GTTGTTGCGACGTCGGCGGAAGTGGCGGCGGTTGAAGCCATGGCGGTGGAGGAGCCGCGG
                      ____________________________________________________________
consensus GTTGTTGCGACGTCGGCGGAAGTGGCGGCGGTTGAAGCCATGGCGGTGGAGGAGCCGCGG
 
. : . : . : . : . : . :
JMFS071D03+ TGGGGACTTGACTTGCTAGTGACGCACTTCG
JMFN033L21+ TGGGGACTTGACTTGCTAGTGA
JMSF032N09+ TGGGGACTTGACTTGCTAGTGACGCACTTCGGGAGGAGATAGACTCGCTC
JMSF019D04+ TGGGGACTTGACTTGCTAGTGACGCACTTCGGGAGGAGATAGACTCGCTCTGCTCCGTTC
                      ____________________________________________________________
consensus TGGGGACTTGACTTGCTAGTGACGCACTTCGGGAGGAGATAGACTCGCTCTGCTCCGTTC