Previous Contig 005802:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF019C20Sequence459005802 (2)gb:AF487527_18042905e-11Nicotiana plumbaginifolia D1 protease-like protein precursor, mRNA, complete cds856013121 (2)gb:AF487527_18042905e-74Nicotiana plumbaginifolia D1 protease-like protein precursor, mRNA, complete cds
JMSF037M24Sequence638005802 (2)gb:AF487527_18042908e-37Nicotiana plumbaginifolia D1 protease-like protein precursor, mRNA, complete cds593013121 (2)gb:AF487527_18042908e-34Nicotiana plumbaginifolia D1 protease-like protein precursor, mRNA, complete cds

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037M24+ ATTGTCACCTGGAACCTCCCGAAGATTT
                      ____________________________________________________________
consensus ATTGTCACCTGGAACCTCCCGAAGATTT
 
. : . : . : . : . : . :
JMSF037M24+ ATTCCAATCCCAGTCATATCATACCTCGCCATCTTGGAGAACTTTCAGAGGTGATGGTAG
                      ____________________________________________________________
consensus ATTCCAATCCCAGTCATATCATACCTCGCCATCTTGGAGAACTTTCAGAGGTGATGGTAG
 
. : . : . : . : . : . :
JMSF037M24+ TAATATATGCCATGGAATAAAAACACTCTGCAGGAGAAAGAAACCGTGTATAAGGATCAC
                      ____________________________________________________________
consensus TAATATATGCCATGGAATAAAAACACTCTGCAGGAGAAAGAAACCGTGTATAAGGATCAC
 
. : . : . : . : . : . :
JMSF037M24+ CCAAGCTGGCCAACATCCTCCTAATGATATCATGAGCTCTTGGTCTTGACTGAATTGATG
                      ____________________________________________________________
consensus CCAAGCTGGCCAACATCCTCCTAATGATATCATGAGCTCTTGGTCTTGACTGAATTGATG
 
. : . : . : . : . : . :
JMSF037M24+ TACTCAAGATGTCCTCTTTCTTACTACGCCAAATTTCAGGAGACCACGAGCGACGGCTAG
JMSF019C20+ TACTACGCCAAATTTCAGGAGACCACGAGCGACGGCTAG
                      ____________________________________________________________
consensus TACTCAAGATGTCCTCTTTCTTACTACGCCAAATTTCAGGAGACCACGAGCGACGGCTAG
 
. : . : . : . : . : . :
JMSF037M24+ TATTGAGAAAGCTATCATTGACAATCTGCCACACCTCCGCCACAATCCCCTCATTACTCA
JMSF019C20+ TATTGAGAAAGCTATCATTGACAATCTGCCACACCTCCGCCACAATCCCCTCATTACTCA
                      ____________________________________________________________
consensus TATTGAGAAAGCTATCATTGACAATCTGCCACACCTCCGCCACAATCCCCTCATTACTCA
 
. : . : . : . : . : . :
JMSF037M24+ CCACTTCAGGCTCCGCCGGCGCCGCACTCAGCTCCTGCTCGTCTTCGCGGCAATCAAGCT
JMSF019C20+ CCACTTCAGGCTCCGCCGGCGCCGCACTCAGCTCCTGCTCGTCTTCGCGGCAATCAAGCT
                      ____________________________________________________________
consensus CCACTTCAGGCTCCGCCGGCGCCGCACTCAGCTCCTGCTCGTCTTCGCGGCAATCAAGCT
 
. : . : . : . : . : . :
JMSF037M24+ GCTGCTCCTCATTCGTCTGCACCAGAGCAACGGCGGACAATCGGTCTGAGGAGAACTCGG
JMSF019C20+ GCTGCTCCTCATTCGTCTGCACCAGAGCAACGGCGGACAATCGGTCTGAGGAGAACTCGG
                      ____________________________________________________________
consensus GCTGCTCCTCATTCGTCTGCACCAGAGCAACGGCGGACAATCGGTCTGAGGAGAACTCGG
 
. : . : . : . : . : . :
JMSF037M24+ AAGCGATTGATGGCGGAGAAATGAGAAGGCCCAAGGAGAGTGCGACGGAGACGCCGGTTG
JMSF019C20+ AAGCGATTGATGGCGGAGAAATGAGAAGGCCCAAGGAGAGTGCGACGGAGACGCCGGTTG
                      ____________________________________________________________
consensus AAGCGATTGATGGCGGAGAAATGAGAAGGCCCAAGGAGAGTGCGACGGAGACGCCGGTTG
 
. : . : . : . : . : . :
JMSF037M24+ TGATGAAAGCTTTCTGAGGAATTGAAGCTTTGTGAAGAGAAGCAGTAGTTAGCCGGGACG
JMSF019C20+ TGATGAAAGCTTTCTGAGGAATTGAAGCTTTGTGAAGAGAAGCAGTAGTTAGCCGGGACG
                      ____________________________________________________________
consensus TGATGAAAGCTTTCTGAGGAATTGAAGCTTTGTGAAGAGAAGCAGTAGTTAGCCGGGACG
 
. : . : . : . : . : . :
JMSF037M24+ GTGGCGGAGGCGGACGCGATGGCGATGGCGGTGGCGGAGGAGAATTTAGTGGCGGGAAGC
JMSF019C20+ GTGGCGGAGGCGGACGCGATGGCGATGGCGGTGGCGGAGGAGAATTTAGTGGCGGGAAGC
                      ____________________________________________________________
consensus GTGGCGGAGGCGGACGCGATGGCGATGGCGGTGGCGGAGGAGAATTTAGTGGCGGGAAGC
 
. : . : . : . : . : . :
JMSF037M24+ GGTTGTTGC
JMSF019C20+ GGTTGTTGCAGAGCGGTAATCTCATCTCCACCGCGTGTTACACTCACTGTGTTACTCTTC
                      ____________________________________________________________
consensus GGTTGTTGCAGAGCGGTAATCTCATCTCCACCGCGTGTTACACTCACTGTGTTACTCTTC