Previous Contig 005801:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF019B22Sequence411005801 (2)gb:NTA414053_16913619e-23Nicotiana tabacum partial mRNA for serine acetyltransferase 7 (sat7 gene).
JMSF034D15Sequence662005801 (2)gb:NTA414053_16913612e-36Nicotiana tabacum partial mRNA for serine acetyltransferase 7 (sat7 gene).725023606gb:NTA414053_16913611e-85Nicotiana tabacum partial mRNA for serine acetyltransferase 7 (sat7 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034D15+ TTCTG
                      ____________________________________________________________
consensus TTCTG
 
. : . : . : . : . : . :
JMSF034D15+ TCACAAATATCAAACTAATTTTCATTTCTTCCTGAAAGTGTAAACTAGCAATTCAAATTC
                      ____________________________________________________________
consensus TCACAAATATCAAACTAATTTTCATTTCTTCCTGAAAGTGTAAACTAGCAATTCAAATTC
 
. : . : . : . : . : . :
JMSF034D15+ CCACAAATGAAAATTAATTTATCAAACTACACTAATTTCCGTAAATTAGCAAGTATAACA
                      ____________________________________________________________
consensus CCACAAATGAAAATTAATTTATCAAACTACACTAATTTCCGTAAATTAGCAAGTATAACA
 
. : . : . : . : . : . :
JMSF034D15+ CAAAAATCAACTCCTAATAGGGAATGATTAAATTATTTTACTTAAAATCGATAAATTACC
                      ____________________________________________________________
consensus CAAAAATCAACTCCTAATAGGGAATGATTAAATTATTTTACTTAAAATCGATAAATTACC
 
. : . : . : . : . : . :
JMSF034D15+ ACAGACCTGGCAAGCGAGGAAGCCTTTGTAATTGAGGAGACAATGAGAGAACGAAACGCA
                      ____________________________________________________________
consensus ACAGACCTGGCAAGCGAGGAAGCCTTTGTAATTGAGGAGACAATGAGAGAACGAAACGCA
 
. : . : . : . : . : . :
JMSF034D15+ GGCGGGATCACGGTATCGAGCGGCGAGGAGATCGGCGACGGTGGCGGCGCGGAGTTCCGG
JMSF019B22+ ACGGTATCGAGCGGCGAGGAGATCGGCGACGGTGGCGGCGCGGAGTTCCGG
                      ____________________________________________________________
consensus GGCGGGATCACGGTATCGAGCGGCGAGGAGATCGGCGACGGTGGCGGCGCGGAGTTCCGG
 
. : . : . : . : . : . :
JMSF034D15+ GTCGGTAGAGAAGGCGTTGATGAAGATGTCGTAGAGAAGCGTCGACAGGAGCGTTGAGGA
JMSF019B22+ GTCGGTAGAGAAGGCGTTGATGAAGATGTCGTAGAGAAGCGTCGACAGGAGCGTTGAGGA
                      ____________________________________________________________
consensus GTCGGTAGAGAAGGCGTTGATGAAGATGTCGTAGAGAAGCGTCGACAGGAGCGTTGAGGA
 
. : . : . : . : . : . :
JMSF034D15+ GCAGAGCTTGTTCCCCAAGTGGAAGGAAATCGAACGGTCCAGCGACGAGTGCGATATTAT
JMSF019B22+ GCAGAGCTTGTTCCCCAAGTGGAAGGAAATCGAACGGTCCAGCGACGAGTGCGATATTAT
                      ____________________________________________________________
consensus GCAGAGCTTGTTCCCCAAGTGGAAGGAAATCGAACGGTCCAGCGACGAGTGCGATATTAT
 
. : . : . : . : . : . :
JMSF034D15+ CGTCGAGTACAAGTAGCTAGCCAGAGCCGGCTCCGCCTCGGCGTCGCGCCGAGCCTCAGC
JMSF019B22+ CGTCGAGTACAAGTAGCTAGCCAGAGCCGGCTCCGCCTCGGCGTCGCGCCGAGCCTCAGC
                      ____________________________________________________________
consensus CGTCGAGTACAAGTAGCTAGCCAGAGCCGGCTCCGCCTCGGCGTCGCGCCGAGCCTCAGC
 
. : . : . : . : . : . :
JMSF034D15+ CTTGATCTGCATCCAAACCCAGGCCGCTTCGTCCGCCAAGTCAGTCGGCGGACTCGGCGC
JMSF019B22+ CTTGATCTGCATCCAAACCCAGGCCGCTTCGTCCGCCAAGTCAGTCGGCGGACTCGGCGC
                      ____________________________________________________________
consensus CTTGATCTGCATCCAAACCCAGGCCGCTTCGTCCGCCAAGTCAGTCGGCGGACTCGGCGC
 
. : . : . : . : . : . :
JMSF034D15+ TGGCGGCGAAGCGTACAGCAAGTTTCCGGCAGTCATCTTCAAAAACGCTGCCGTTTCAGC
JMSF019B22+ TGGCGGCGAAGCGTACAGCAAGTTTCCGGCAGTCATCTTCAAAAACGCTGCCGTTTCAGC
                      ____________________________________________________________
consensus TGGCGGCGAAGCGTACAGCAAGTTTCCGGCAGTCATCTTCAAAAACGCTGCCGTTTCAGC
 
. : . : . : . : . : . :
JMSF034D15+ TTCCGTGTTCGTTGAAGGTAGGTTCGAAATCGCTAGGAATCTATATACAGCGACAT
JMSF019B22+ TTCCGTGTTCGTTGAAGGTAGGTTCGAAATCGCTAGGAATCTATATACAGCGACATAGCC
                      ____________________________________________________________
consensus TTCCGTGTTCGTTGAAGGTAGGTTCGAAATCGCTAGGAATCTATATACAGCGACATAGCC