Previous Contig 005797:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011P02Sequence502005797 (3)gb:AY045854_15613662e-52Arabidopsis thaliana putative N-myristoyl transferase (At5g57020) mRNA, complete623012054 (3)gb:AP003273_18269596e-33Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051
JMSF019A20Sequence268005797 (3)792012054 (3)gb:AP003273_18269591e-57Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051
JMSF050G21Sequence654005797 (3)gb:AY045854_15613662e-66Arabidopsis thaliana putative N-myristoyl transferase (At5g57020) mRNA, complete721012054 (3)gb:AP003273_18269594e-66Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF050G21+ TTGTGGACGCACAAA
                      ____________________________________________________________
consensus TTGTGGACGCACAAA
 
. : . : . : . : . : . :
JMFF011P02+ GATCACGAACCCTCATTTTCCACAGGAATGCC
JMSF050G21+ AAGTTAACTTCAGCCATCTTAAAAACCTGATCACGAACCCTCATTTT-CACAGGAATACC
                      ____________________________________________________________
consensus AAGTTAACTTCAGCCATCTTAAAAACCTGATCACGAACCCTCATTTTCCACAGGAATGCC
 
. : . : . : . : . : . :
JMFF011P02+ ACTGATAAAAGCAACCAACTTCCCAGATCCCCTTCACTCGAACTCCAATATGCCAATTAC
JMSF050G21+ ACTGATAAAAGCAACCAACTTCCCAGAT-CCCTTCACTCGAACTCCAATATGCCAATTAC
                      ____________________________________________________________
consensus ACTGATAAAAGCAACCAACTTCCCAGATCCCCTTCACTCGAACTCCAATATGCCAATTAC
 
. : . : . : . : . : . :
JMFF011P02+ TAAAAAAACCAGGAGAGCACAAAGCCCATCGAAGAAACTCCTTTGAGTAATTAAACCTGA
JMSF050G21+ TAAAAAAACCAGGAGAGCACAAAGCCCATCGAAGAAACTCCTTTGAGTAATTAAACCTGA
                      ____________________________________________________________
consensus TAAAAAAACCAGGAGAGCACAAAGCCCATCGAAGAAACTCCTTTGAGTAATTAAACCTGA
 
. : . : . : . : . : . :
JMFF011P02+ ACATGTGATCATCATCCTCGACATAGTTATTAGTCAGTAAAGTATAGACCTCAGCACAGA
JMSF050G21+ ACATGTGATCATCATCCTCGACATAGTTATTAGTCAGTAAAGTATAGACCTCAGCACAGA
                      ____________________________________________________________
consensus ACATGTGATCATCATCCTCGACATAGTTATTAGTCAGTAAAGTATAGACCTCAGCACAGA
 
. : . : . : . : . : . :
JMFF011P02+ CCTCATCAGAGTTCATATCACACACTGTCCACTCATACGAACTTGGAAGATTATACGGCT
JMSF050G21+ CCTCATCAGAGTTCATATCACACACTGTCCACTCATACGAACTTGGAAGATTATACGGCT
                      ____________________________________________________________
consensus CCTCATCAGAGTTCATATCACACACTGTCCACTCATACGAACTTGGAAGATTATACGGCT
 
. : . : . : . : . : . :
JMFF011P02+ CTTGTTTGACCTCAGAGATCGGTGTAGGCTCCTCAATAGAACCCTCAGGTACACTGGCAT
JMSF050G21+ CTTGTTTGACCTCAGAGATCGGTGTAGGCTCCTCAATAGAACCCTCAGGTACACTGGCAT
                      ____________________________________________________________
consensus CTTGTTTGACCTCAGAGATCGGTGTAGGCTCCTCAATAGAACCCTCAGGTACACTGGCAT
 
. : . : . : . : . : . :
JMFF011P02+ TCCCTACATCCTTAAATTGCCCCACTGGTTGGGTTTCCCAAAATTTGTGCTGCTGCCCCA
JMSF050G21+ TCCCTACATCCTTAAATTGCCCCACTGGTTGGGTTTCCCAAAATTTGTGCTGCTGCCCCA
JMSF019A20+ AAAATTTGTGCTGCTGCCCCA
                      ____________________________________________________________
consensus TCCCTACATCCTTAAATTGCCCCACTGGTTGGGTTTCCCAAAATTTGTGCTGCTGCCCCA
 
. : . : . : . : . : . :
JMFF011P02+ TGGGGTTCGAGTTCTGGAACTGCTGAACTAGATTTTCAAGAGTGTTTCTATAGTCAGAAA
JMSF050G21+ TGGGGTTCGAGTTCTGGAACTGCTGAACTAGATTTTCAAGAGTGTTTCTATAGTCAGAAA
JMSF019A20+ TGGGGTTCGAGTTCTGGAACTGCTGAACTAGATTTTCAAGAGTGTTTCTATAGTCAGAAA
                      ____________________________________________________________
consensus TGGGGTTCGAGTTCTGGAACTGCTGAACTAGATTTTCAAGAGTGTTTCTATAGTCAGAAA
 
. : . : . : . : . : . :
JMFF011P02+ CTGGGTTTTCATTAGAATCCCCATTTGAGTTTCCCTTATTGGATCCAGAA
JMSF050G21+ CTGGGTTTTCATTAGAATCCCCATTTGAGTTTCCCTTATTGGATCCAGAACCAGTTCCCT
JMSF019A20+ CTGGGTTTTCATTAGAATCCCCATTTGAGTTTCCCTTATTGGATCCAGAACCAGTTCCCT
                      ____________________________________________________________
consensus CTGGGTTTTCATTAGAATCCCCATTTGAGTTTCCCTTATTGGATCCAGAACCAGTTCCCT
 
. : . : . : . : . : . :
JMSF050G21+ TATCAGCCATTCCAAGCTAGCCAAGAAAATTCTGAACTTCTTCTCAATCTCTAAGCTATA
JMSF019A20+ TATCAGCCATTCCAAGCTAGCCAAGAAAATTCTGAACTTCTTCTCAATCTCTAAGCTATA
                      ____________________________________________________________
consensus TATCAGCCATTCCAAGCTAGCCAAGAAAATTCTGAACTTCTTCTCAATCTCTAAGCTATA
 
. : . : . : . : . : . :
JMSF050G21+ AACATTTGCATTCTGAAGCTCTGAACTGTGAGTGAGGCGT
JMSF019A20+ AACATTTGCATTCTGAAGCTCTGAACTGTGAGTGAGGCGTGAAGTGTACGCCGGACATTC
                      ____________________________________________________________
consensus AACATTTGCATTCTGAAGCTCTGAACTGTGAGTGAGGCGTGAAGTGTACGCCGGACATTC