Previous Contig 005791:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF018P12Sequence436005791 (3)gb:BT002812_16364061e-14Arabidopsis thaliana clone RAFL15-01-L13 (R20191) unknown protein (At1g06510) mR
JMSF035A15Sequence669005791 (3)gb:BT002812_16364064e-34Arabidopsis thaliana clone RAFL15-01-L13 (R20191) unknown protein (At1g06510) mR141023655
JMSF043I21Sequence757005791 (3)gb:BT002812_16364064e-35Arabidopsis thaliana clone RAFL15-01-L13 (R20191) unknown protein (At1g06510) mR

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043I21+ CATTCCATGCGTTCCCACTACCCGATGCCTCCTCGTT
                      ____________________________________________________________
consensus CATTCCATGCGTTCCCACTACCCGATGCCTCCTCGTT
 
. : . : . : . : . : . :
JMSF035A15+ TCTGCTACACTGTGATCGAGATATTGCAGTTC
JMSF043I21+ ATTATTCAACTTGTTATCAGCTTCAAGGTCTGCTACACTGTGATCGAGATATTGCAGTTC
                      ____________________________________________________________
consensus ATTATTCAACTTGTTATCAGCTTCAAGGTCTGCTACACTGTGATCGAGATATTGCAGTTC
 
. : . : . : . : . : . :
JMSF035A15+ TTGATCATTACTAACTTCAACCGCATCCTGGACGTGGACTTGATTTTCGTCTGAATCATT
JMSF043I21+ TTGATCATTACTAACTTCAACCGCATCCTGGACGTGGACTTGATTTTCGTCTGAATCATT
                      ____________________________________________________________
consensus TTGATCATTACTAACTTCAACCGCATCCTGGACGTGGACTTGATTTTCGTCTGAATCATT
 
. : . : . : . : . : . :
JMSF035A15+ ACAATCTCTCTCTTTTGGAGAAACTATTCTAACAGCACTAGGAATATCTTCCGCTTCAAT
JMSF043I21+ ACAATCTCTCTCTTTTGGAGAAACTATTCTAACAGCACTAGGAATATCTTCCGCTTCAAT
                      ____________________________________________________________
consensus ACAATCTCTCTCTTTTGGAGAAACTATTCTAACAGCACTAGGAATATCTTCCGCTTCAAT
 
. : . : . : . : . : . :
JMSF035A15+ TTCAAGGTCTAAAGAAACATTTCCTATCAGCTGCGTCTCCCTCATAGTTATTGCCTCGTT
JMSF043I21+ TTCAAGGTCTAAAGAAACATTTCCTATCAGCTGCGTCTCCCTCATAGTTATTGCCTCGTT
                      ____________________________________________________________
consensus TTCAAGGTCTAAAGAAACATTTCCTATCAGCTGCGTCTCCCTCATAGTTATTGCCTCGTT
 
. : . : . : . : . : . :
JMSF035A15+ AAGTTTTGCAGCAAGCTCATCAAGCAATTCAATGCGATTCTTTGACTTCTCCATTGCTTG
JMSF043I21+ AAGTTTTGCAGCAAGCTCATCAAGCAATTCAATGCGATTCTTTGACTTCTCCATTGCTTG
JMSF018P12+ ACTTCTCCATTGCTTG
                      ____________________________________________________________
consensus AAGTTTTGCAGCAAGCTCATCAAGCAATTCAATGCGATTCTTTGACTTCTCCATTGCTTG
 
. : . : . : . : . : . :
JMSF035A15+ CATAACCTTCTTCTTTTGGATTAGCATCTCCCTGGCATCATCCTCCTTTCCAGATTGAAC
JMSF043I21+ CATAACCTTCTTCTTTTGGATTAGCATCTCCCTGGCATCATCCTCCTTTCCAGATTGAAC
JMSF018P12+ CATAACCTTCTTCTTTTGGATTAGCATCTCCCTGGCATCATCCTCCTTTCCAGATTGAAC
                      ____________________________________________________________
consensus CATAACCTTCTTCTTTTGGATTAGCATCTCCCTGGCATCATCCTCCTTTCCAGATTGAAC
 
. : . : . : . : . : . :
JMSF035A15+ ACTAATTGCGGCTTGCCTTCGAAGCTTATCTGCTGCTTCAGACAACCTTAGTAGCCTCAA
JMSF043I21+ ACTAATTGCGGCTTGCCTTCGAAGCTTATCTGCTGCTTCAGACAACCTTAGTAGCCTCAA
JMSF018P12+ ACTAATTGCGGCTTGCCTTCGAAGCTTATCTGCTGCTTCAGACAACCTTAGTAGCCTCAA
                      ____________________________________________________________
consensus ACTAATTGCGGCTTGCCTTCGAAGCTTATCTGCTGCTTCAGACAACCTTAGTAGCCTCAA
 
. : . : . : . : . : . :
JMSF035A15+ TCTTGCATTATTTGCTTTGGCCCTTGTCTTGTCGGCTTCCTTGTGAAGATGATCCAACTG
JMSF043I21+ TCTTGCATTATTTGCTTTGGCCCTTGTCTTGTCGGCTTCCTTGTGAAGATGATCCAACTG
JMSF018P12+ TCTTGCATTATTTGCTTTGGCCCTTGTCTTGTCGGCTTCCTTGTGAAGATGATCCAACTG
                      ____________________________________________________________
consensus TCTTGCATTATTTGCTTTGGCCCTTGTCTTGTCGGCTTCCTTGTGAAGATGATCCAACTG
 
. : . : . : . : . : . :
JMSF035A15+ TTCCCGGAGCTGGTCTGTGTTGAGGGTTTTAGAAGAAGCGAAGCACGCTGTGGTGGTTGG
JMSF043I21+ TTCCCGGAGCTGGTCTGTGTTGAGGGTTTTAGAAGAAGCGAAGCACGCTGTGGTGGTTGG
JMSF018P12+ TTCCCGGAGCTGGTCTGTGTTGAGGGTTTTAGAAGAAGCGAAGCACGCTGTGGTGGTTGG
                      ____________________________________________________________
consensus TTCCCGGAGCTGGTCTGTGTTGAGGGTTTTAGAAGAAGCGAAGCACGCTGTGGTGGTTGG
 
. : . : . : . : . : . :
JMSF035A15+ AACAAGTAGAGGCCTCCATTGAAGAAATGCAGGAGAAGTCCAATTCAGAATCATAATCCT
JMSF043I21+ AACAAGTAGAGGCCTCCATTGAAGAAATGCAGGAGAAGTCCAATTCAGAATCATAATCCT
JMSF018P12+ AACAAGTAGAGGCCTCCATTGAAGAAATGCAGGAGAAGTCCAATTCAGAATCATAATCCT
                      ____________________________________________________________
consensus AACAAGTAGAGGCCTCCATTGAAGAAATGCAGGAGAAGTCCAATTCAGAATCATAATCCT
 
. : . : . : . : . : . :
JMSF035A15+ ATTTGCTGAAATGTGTAGACAATTGGATTAGCCGATTAGGTCAGAGTTGGGACTTCGGAG
JMSF043I21+ ATTTGCTGAAATGTGTAGACAATTGGATTAGCCGATTAGGTCAGAGTTGGGACTTCGGAG
JMSF018P12+ ATTTGCTGAAATGTGTAGACAATTGGATTAGCCGATTAGGTCAGAGTTGGGACTTCGGAG
                      ____________________________________________________________
consensus ATTTGCTGAAATGTGTAGACAATTGGATTAGCCGATTAGGTCAGAGTTGGGACTTCGGAG
 
. : . : . : . : . : . :
JMSF035A15+ TTCGGAAACGACACTGAAGACTAAAGATTGAGAACT
JMSF043I21+ TTCGGAAACGACACTGAAGACTAAAGATTGAGAACTGGTAAGTGTCAAGTCAGAACCGCC
JMSF018P12+ TTCGGAAACGACACTGAAGACTAAAGATTGAGAACTGGTAAGTGTCAAGTCAGAACCGCC
                      ____________________________________________________________
consensus TTCGGAAACGACACTGAAGACTAAAGATTGAGAACTGGTAAGTGTCAAGTCAGAACCGCC