Previous Contig 005783:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF018O06Sequence482005783 (3)gb:MFL297739_16860327e-23Malus floribunda hcrVf1 gene.749013761 (3)pir|S49300|S493001e-27AWJL236 protein - wheat>gb:TAAWJL236_1724224 T.aestivumn (subclone pAWJL236) AWJ
JMSF029C12Sequence663005783 (3)gb:MFL297741_16860345e-38Malus floribunda hcrVf3 gene.669013761 (3)pir|S49300|S493002e-25AWJL236 protein - wheat>gb:TAAWJL236_1724224 T.aestivumn (subclone pAWJL236) AWJ
JMSF048D01Sequence743005783 (3)gb:MFL297739_16860323e-47Malus floribunda hcrVf1 gene.750013761 (3)gb:AF215729_17779471e-24Glycine max RFLP clone A 45-10 sequence; and unknown gene.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF048D01+ GTAGGANCCAAAAG
                      ____________________________________________________________
consensus GTAGGANCCAAAAG
 
. : . : . : . : . : . :
JMSF048D01+ GGAGGAATAGTTGTGATGATGAAGTGAAGATGAAATGTTAGCAAGACTACAACCAGAGAA
                      ____________________________________________________________
consensus GGAGGAATAGTTGTGATGATGAAGTGAAGATGAAATGTTAGCAAGACTACAACCAGAGAA
 
. : . : . : . : . : . :
JMSF048D01+ ACGAAGGTGCTGTAAAGAAGGAAGAGCAGAAGTGACCTGTACCCAGTTGGGAGCGTTGCT
                      ____________________________________________________________
consensus ACGAAGGTGCTGTAAAGAAGGAAGAGCAGAAGTGACCTGTACCCAGTTGGGAGCGTTGCT
 
. : . : . : . : . : . :
JMSF048D01+ TAGATCCACATAGCTCAAGTCCAGTCGCTGGAGATTGGAAAGGCTTGATAACCATTCAAG
                      ____________________________________________________________
consensus TAGATCCACATAGCTCAAGTCCAGTCGCTGGAGATTGGAAAGGCTTGATAACCATTCAAG
 
. : . : . : . : . : . :
JMSF048D01+ GCTATCAACTTTGAGACCACCAAGAGAGTAATCGGAAAGACTTGGAGTAGTTCTCTGCCC
                      ____________________________________________________________
consensus GCTATCAACTTTGAGACCACCAAGAGAGTAATCGGAAAGACTTGGAGTAGTTCTCTGCCC
 
. : . : . : . : . : . :
JMSF048D01+ CATCCCCAGGGAGATTTCAAGAAACCCTGAACTTACAGGAGAGGAATAACCAGGCCCCCG
                      ____________________________________________________________
consensus CATCCCCAGGGAGATTTCAAGAAACCCTGAACTTACAGGAGAGGAATAACCAGGCCCCCG
 
. : . : . : . : . : . :
JMSF048D01+ TATAGTCACCGTGTGTAAGCCTGTGAGATTACCAAGCTGATGGGGAATGATACCTTGGAA
JMSF029C12+ TGTGTAAACCTGTAAGATTTCCCAGGTGATGAGGAATGTCACCTTCGAA
                      ____________________________________________________________
consensus TATAGTCACCGTGTGTAAGCCTGTGAGATTTCCCAGGTGATGGGGAATGTTACCTTGGAA
 
. : . : . : . : . : . :
JMSF048D01+ CCCAGCATCGGCTAGATCGAGATATTCCAGATTTAGTAGAGATCCTAGGAAGCCTGGGAT
JMSF029C12+ TCCAGCTTCTGATAGATCGAGATATTCTAGATTTAGTAGAGATCCTAGGAAGCCTGGGAT
JMSF018O06+ GGGAT
                      ____________________________________________________________
consensus TCCAGCTTCTGCTAGATCGAGATATTCTAGATTTAGTAGAGATCCTAGGAAGCCTGGGAT
 
. : . : . : . : . : . :
JMSF048D01+ GGGAATTCCTTCAAAATCATTTCCGCTAAGATCCAGGTGACTTAGTTGTTTCAATTCCAG
JMSF029C12+ GGGAGTTCCTTCAAAATCATTTCCGCTAAGGTCCAGGTGACTTAGTTGTTTCAATTCCAG
JMSF018O06+ GGGAGTTCCTTCAAAATCATTTCCGCTAAGGTCCAGGTGACTTAGTTGTTTCAATTCCAG
                      ____________________________________________________________
consensus GGGAGTTCCTTCAAAATCATTTCCGCTAAGGTCCAGGTGACTTAGTTGTTTCAATTCCAG
 
. : . : . : . : . : . :
JMSF048D01+ CAAACAGGGACTTAGTTCACCCCCAAAAGCTGAGCTCCCATTGCCT------GGATTGGC
JMSF029C12+ CAAACAGGAACTTAGTTCACCGCCAAAAGCTGAACTGCCATTGCCTGGAGCGGGATTGGC
JMSF018O06+ CAAACAGGAACTTAGTTCACCGCCAAAAGCTGAACTGCCATTGCCTGGAGCGGGATTGGC
                      ____________________________________________________________
consensus CAAACAGGAACTTAGTTCACCGCCAAAAGCTGAACTGCCATTGCCTGGAGCGGGATTGGC
 
. : . : . : . : . : . :
JMSF048D01+ GAGGTGGAGCTCAGTGACATGGCCACTTACGTTGTTGCACACAACTCCAGCCCATTTAGT
JMSF029C12+ GAGGTGGAGCTCAGTGACATGGCCAGTTACGTTGTTGCACACAACTCCATCCCATTTACT
JMSF018O06+ GAGGTGGAGCTCAGTGACATGGCCAGTTACGTTGTTGCACACAACTCCATCCCATTTACT
                      ____________________________________________________________
consensus GAGGTGGAGCTCAGTGACATGGCCAGTTACGTTGTTGCACACAACTCCATCCCATTTACT
 
. : . : . : . : . : . :
JMSF048D01+ ACAACAATCATCGTAGTCTCCATCCATATCAACCCAAGACCGAAGCCGACTGGATGGATC
JMSF029C12+ ACAACAAT---CGTAGTCTCCATCAATATCAACCCAAGACCAAAGCCGACTGGATGGATC
JMSF018O06+ ACAACAAT---CGTAGTCTCCATCAATATCAACCCAAGACCAAAGCCGACTGGATGGATC
                      ____________________________________________________________
consensus ACAACAAT---CGTAGTCTCCATCAATATCAACCCAAGACCAAAGCCGACTGGATGGATC
 
. : . : . : . : . : . :
JMSF048D01+ CTTTAAACCCTTCTTGAAGCACAGCAAGGCCTGCTTTTCATCTTTTCTGCAAATCGGGTT
JMSF029C12+ CTTTAACCCCTTCTTGAAGCACAGCAAGGCCTGCTTTTCATCTTTTCTGCAAATCGGGGT
JMSF018O06+ CTTTAACCCCTTCTTGAAGCACAGCAAGGCCTGCTTTTCATCTTTTCTGCAAATCGGGGT
                      ____________________________________________________________
consensus CTTTAACCCCTTCTTGAAGCACAGCAAGGCCTGCTTTTCATCTTTTCTGCAAATCGGGGT
 
. : . : . : . : . : . :
JMSF048D01+ TGGGTTTCCGCTAC
JMSF029C12+ TGGGTTTCCGCTAC-AAAACCCAAACTCAGTTACCATAAAAACAAAGATGAAGAAGGGAA
JMSF018O06+ TGGGTTTCCGCTACAAAAACCCAAACTCAGTTACCATAAAAACAAAGATGAAGAAGGGAA
                      ____________________________________________________________
consensus TGGGTTTCCGCTACAAAAACCCAAACTCAGTTACCATAAAAACAAAGATGAAGAAGGGAA
 
. : . : . : . : . : . :
JMSF029C12+ CAGGATTTATTATAGGCAGCCTGCAGCCACTCATGATGAAGCTAATAAGGGAGATTACTA
JMSF018O06+ CAGGATTTATTATAGGCAGCCTGCAGCCACTCATGATGAAGCTAATAAGGGAGATTACTA
                      ____________________________________________________________
consensus CAGGATTTATTATAGGCAGCCTGCAGCCACTCATGATGAAGCTAATAAGGGAGATTACTA
 
. : . : . : . : . : . :
JMSF029C12+ TTATTATATTATTTCTTATGGCCTGTTTTGAAATATAGTTTTGCGTGGATGCAATGCT
JMSF018O06+ TTATTATATTATTTCTTATGGCCTGTTTTGAAATATAGTTTTGCGTGGATGCAATGCTCC
                      ____________________________________________________________
consensus TTATTATATTATTTCTTATGGCCTGTTTTGAAATATAGTTTTGCGTGGATGCAATGCTCC