Previous Contig 005774:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN035J22Sequence363005774 (6)gb:AP004120_18378867e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12
JMFN046O07Sequence521005774 (6)gb:AP004120_18378866e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12
JMSF018M20Sequence478005774 (6)gb:AP004120_18378862e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12419005774 (6)gb:AP004120_18378862e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12
JMSF038A11Sequence502005774 (6)gb:AP004120_18378863e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12441005774 (6)gb:AP004120_18378862e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN046O07+ AATTTGATGAAGGGGGTCTGACTTCTGAGTTTAATAA
                      ____________________________________________________________
consensus AATTTGATGAAGGGGGTCTGACTTCTGAGTTTAATAA
 
. : . : . : . : . : . :
JMFN046O07+ TATCAAGCAATACAAAATTAAGTTACAACTAGCTTTCAAAGAAGATATAGGGTAGAATCT
JMSF038A11+ TAGGGTAGAATCT
                      ____________________________________________________________
consensus TATCAAGCAATACAAAATTAAGTTACAACTAGCTTTCAAAGAAGATATAGGGTAGAATCT
 
. : . : . : . : . : . :
JMFN046O07+ GAATCTGCTTGTCAGAAAACAAAATAATCCACATTGACAACAACTGGTCCTCTAACAAGC
JMSF038A11+ GAATCTGCTTGTCAGAAAACAAAATAATCCACATTGACAACAACTGGTCCTCTAACAAGC
rJMSF038A11- ACAACTGGTCCTCTAACAAGC
JMSF018M20+ TCAGAAAACAAAATAATCCACATTGACAACAACTGGTCCTCTAACAAGC
                      ____________________________________________________________
consensus GAATCTGCTTGTCAGAAAACAAAATAATCCACATTGACAACAACTGGTCCTCTAACAAGC
 
. : . : . : . : . : . :
JMFN046O07+ AAAAACCAAACATGTTTTGTAATAAAATTTGGGAAACTCTTGGAAGAATAAAAACACTGC
JMSF038A11+ AAAAACCAAACATGTTTTGTAATAAAATTTGGGAAACTCTTGGAAGAATAAAAACACTGC
rJMSF038A11- AAAAACCAAACATGTTTTGTAATAAAATTTGGGAAACTCTTGGAAGAATAAAAACACTGC
JMFN035J22+ AAATTGGGGAAACTCTTGGAAGAATAAAAACGCTGC
rJMSF018M20- AAAACCAAACATGTTTTGTAATAAAATTTGGGAAACTCTTGGAAGAATAAAAACACTGC
JMSF018M20+ AAAAACCAAACATGTTTTGTAATAAAATTTGGGAAACTCTTGGAAGAATAAAAACACTGC
                      ____________________________________________________________
consensus AAAAACCAAACATGTTTTGTAATAAAATTTGGGAAACTCTTGGAAGAATAAAAACACTGC
 
. : . : . : . : . : . :
JMFN046O07+ TAAAACTGAGGAAATGAAATTTAAGAGGCTGCTGCTGCTCCCTTCTTCCTTGGAGTTGCC
JMSF038A11+ TAAAACTGAGGAAATGAAATTTAAGAGGCTGCTGCTGCTCCCTTCTTCCTTGGAGTTGCC
rJMSF038A11- TAAAACTGAGGAAATGAAATTTAAGAGGCTGCTGCTGCTCCCTTCTTCCTTGGAGTTGCC
JMFN035J22+ TAAGAGTGAGGAAATGAAATTTAAGAGGCTGCTGCTGCTCCCTTCTTCCTTGGAGTTGCC
rJMSF018M20- TAAAACTGAGGAAATGAAATTTAAGAGGCTGCTGCTGCTCCCTTCTTCCTTGGAGTTGCC
JMSF018M20+ TAAAACTGAGGAAATGAAATTTAAGAGGCTGCTGCTGCTCCCTTCTTCCTTGGAGTTGCC
                      ____________________________________________________________
consensus TAAAACTGAGGAAATGAAATTTAAGAGGCTGCTGCTGCTCCCTTCTTCCTTGGAGTTGCC
 
. : . : . : . : . : . :
JMFN046O07+ TCAGTACCTTCTCTGAAGTTGGTCTTGAATCTACGAGGAACATTGCGAAGATACCTCATG
JMSF038A11+ TCAGTACCTTCTCTGAAGTTGGTCTTGAATCTACGAGGAACATTGCGAAGATACCTCATG
rJMSF038A11- TCAGTACCTTCTCTGAAGTTGGTCTTGAATCTACGAGGAACATTGCGAAGATACCTCATG
JMFN035J22+ TCAGTACGTTCTCTGAAGTTGGTCTTGAATCTACGAGGAACAGTGCGAAGATGCCTCATG
rJMSF018M20- TCAGTACCTTCTCTGAAGTTGGTCTTGAATCTACGAGGAACATTGCGAAGATACCTCATG
JMSF018M20+ TCAGTACCTTCTCTGAAGTTGGTCTTGAATCTACGAGGAACATTGCGAAGATACCTCATG
                      ____________________________________________________________
consensus TCAGTACCTTCTCTGAAGTTGGTCTTGAATCTACGAGGAACATTGCGAAGATACCTCATG
 
. : . : . : . : . : . :
JMFN046O07+ CGGCCAGTTCCAGTAGTCTTTCTCCTAATTGCCTTGACACTCCAATTATATTTTCTAATG
JMSF038A11+ CGGCCAGTTCCAGTAGTCTTTCTCCTAATTGCCTTGACACTCCAATTATATTTTCTAATG
rJMSF038A11- CGGCCAGTTCCAGTAGTCTTTCTCCTAATTGCCTTGACACTCCAATTATATTTTCTAATG
JMFN035J22+ CGGCCAGTTCCAGTAGTCTTTCTCCTAATTGCCTTGACACTCCAATTATATTTTGTAATG
rJMSF018M20- CGGCCAGTTCCAGTAGTCTTTCTCCTAATTGCCTTGACACTCCAATTATATTTTCTAATG
JMSF018M20+ CGGCCAGTTCCAGTAGTCTTTCTCCTAATTGCCTTGACACTCCAATTATATTTTCTAATG
                      ____________________________________________________________
consensus CGGCCAGTTCCAGTAGTCTTTCTCCTAATTGCCTTGACACTCCAATTATATTTTCTAATG
 
. : . : . : . : . : . :
JMFN046O07+ CGTGCAGCAGGATAGGCACAAGCGGAACACCGGCTCTTCTGGATATGGAAGCTGCGGCGG
JMSF038A11+ CGTGCAGCAGGATAGGCACAAGCGGAACACCGGCTCTTCTGGATATGGAAGCTGCGGCGG
rJMSF038A11- CGTGCAGCAGGATAGGCACAAGCGGAACACCGGCTCTTCTGGATATGGAAGCTGCGGCGG
JMFN035J22+ CGTGCAGCAGGATAGGCACAAGCGGAACACCGGCTCTTCTGGATATGGAAGCTGCGGCGG
rJMSF018M20- CGTGCAGCAGGATAGGCACAAGCGGAACACCGGCTCTTCTGGATATGGAAGCTGCGGCGG
JMSF018M20+ CGTGCAGCAGGATAGGCACAAGCGGAACACCGGCTCTTCTGGATATGGAAGCTGCGGCGG
                      ____________________________________________________________
consensus CGTGCAGCAGGATAGGCACAAGCGGAACACCGGCTCTTCTGGATATGGAAGCTGCGGCGG
 
. : . : . : . : . : . :
JMFN046O07+ CCGCATCTCACACATAGTGTATGTGTCTTGTTCCTCCGCTTACCAAAACTTCCGGTACCT
JMSF038A11+ CCGCATCTCACACATAGTGTATGTGTCTTGTTCCTCCGCTTACCAAAACTTCCGGTACCT
rJMSF038A11- CCGCATCTCACACATAGTGTATGTGTCTTGTTCCTCCGCTTACCAAAACTTCCGGTACCT
JMFN035J22+ CCGCATCTCACACATAGTGTATGTGTCTTGTTCCTCCGCTTACCAAAACTTCCGGTACCT
rJMSF018M20- CCGCATCTCACACATAGTGTATGTGTCTTGTTCCTCCGCTTACCAAAACTTCCGGTACCT
JMSF018M20+ CCGCATCTCACACATAGTGTATGTGTCTTGTTCCTCCGCTTACCAAAACTTCCGGTACCT
                      ____________________________________________________________
consensus CCGCATCTCACACATAGTGTATGTGTCTTGTTCCTCCGCTTACCAAAACTTCCGGTACCT
 
. : . : . : . : . : . :
JMFN046O07+ TTTC
JMSF038A11+ TTTCCCATTTGCGCAGCGGAGGCGAAAAACCCTGGCTTCTGAAGTTCGCAGTAGATCTCC
rJMSF038A11- TTTCCCATTTGCGCAGCGGAGGCGAAAAACCCTGGCTTCTGAAGTTCGCAGTAGATCTCC
JMFN035J22+ TTTCCCATTTGCGCAGCGGAGGCGAAA
rJMSF018M20- TTTCCCATTTGCGCAGCGGAGGCGAAAAACCCTGGCTTCTGAAGTTCGCAGTAGATCTCC
JMSF018M20+ TTTCCCATTTGCGCAGCGGAGGCGAAAAACCCTGGCTTCTGAAGTTCGCAGTAGATCTCC
                      ____________________________________________________________
consensus TTTCCCATTTGCGCAGCGGAGGCGAAAAACCCTGGCTTCTGAAGTTCGCAGTAGATCTCC