Previous Contig 005771:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009A09Sequence548005771 (5)697004024 (5)gb:AY093112_15750663e-45Arabidopsis thaliana unknown protein (At3g17040) mRNA, complete cds.>gb:BT008405
JMFF023N11Sequence533005771 (5)749004024 (5)gb:AY093112_15750661e-52Arabidopsis thaliana unknown protein (At3g17040) mRNA, complete cds.>gb:BT008405
JMSF018M05Sequence347005771 (5)
JMSF019A13Sequence457005771 (5)764004024 (5)gb:AY093112_15750664e-68Arabidopsis thaliana unknown protein (At3g17040) mRNA, complete cds.>gb:BT008405
JMSF029L03Sequence638005771 (5)732004024 (5)gb:AY093112_15750666e-60Arabidopsis thaliana unknown protein (At3g17040) mRNA, complete cds.>gb:BT008405

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF029L03+ TCTTCAACAATGTCATCATTGTACAATTCATTTTGGCTCCTGGC
                      ____________________________________________________________
consensus TCTTCAACAATGTCATCATTGTACAATTCATTTTGGCTCCTGGC
 
. : . : . : . : . : . :
JMFF023N11+ GTGGGAAGGATGA
JMFF009A09+ CTAGGACAAGTGAAGGTGGGAAGGATGA
JMSF029L03+ CTTTGATGAAGATGTTGAGGCTTCGGGTTTTTCTAGGACAAGTGAAGGTGGGAAGGATGA
                      ____________________________________________________________
consensus CTTTGATGAAGATGTTGAGGCTTCGGGTTTTTCTAGGACAAGTGAAGGTGGGAAGGATGA
 
. : . : . : . : . : . :
JMFF023N11+ TTCATGGGAACATAAGGGAGGAAGGAGAGAATGTGAAGAAGTATAGAAGAATCTAAAGGG
JMFF009A09+ TTCATGGGAACATAAGGGAGGAAGGAGAGAATGTGAAGAAGTATAGAAGAATCTAAAGGG
JMSF029L03+ TTCATGGGAACATAAGGGAGGAAGGAGAGAATGTGAAGAAGTATAGAAGAATCTAAAGGG
                      ____________________________________________________________
consensus TTCATGGGAACATAAGGGAGGAAGGAGAGAATGTGAAGAAGTATAGAAGAATCTAAAGGG
 
. : . : . : . : . : . :
JMFF023N11+ AAAAGGAAGGTGAAATTTCATGGCATTTTGATTCTGCGAATGATAAAAGAGATGAAATTT
JMFF009A09+ AAAAGGAAGGTGAAATTTCATGGCATTTTGATTCTGCGAATGATAAAAGAGATGAAATTT
JMSF029L03+ AAAAGGAAGGTGAAATTTCATGGCATTTTGATTCTGCGAATGATAAAAGAGATGAAATTT
JMSF019A13+ TCATGGCATTTTGATTCTGCGAATGATAAAAGAGATGAAATTT
                      ____________________________________________________________
consensus AAAAGGAAGGTGAAATTTCATGGCATTTTGATTCTGCGAATGATAAAAGAGATGAAATTT
 
. : . : . : . : . : . :
JMFF023N11+ GGAGCTCGAGAACGATGAAAAGCAACAGTGATTCATTTCTTCTCCCTATACAATTTCTAT
JMFF009A09+ GGAGCTCGAGAACGATGAAAAGCAACAGTGATTCATTTCTTCTCCCTATACAATTTCTAT
JMSF029L03+ GGAGCTCGAGAACGATGAAAAGCAACAGTGATTCATTTCTTCTCCCTATACAATTTCTAT
JMSF019A13+ GGAGCTCGAGAACGATGAAAAGCAACAGTGATTCATTTCTTCTCCCTATACAATTTCTAT
                      ____________________________________________________________
consensus GGAGCTCGAGAACGATGAAAAGCAACAGTGATTCATTTCTTCTCCCTATACAATTTCTAT
 
. : . : . : . : . : . :
JMFF023N11+ AATTAGATCAAACTCTATCTTTATAAGGCAGCTCCGTAGAAAAGCGAGTTTTTTCTAAGG
JMFF009A09+ AATTAGATCAAACTCTATCTTTATAAGGCAGCTCCGTAGAAAAGCGAGTTTTTTCTAAGG
JMSF029L03+ AATTAGATCAAACTCTATCTTTATAAGGCAGCTCCGTAGAAAAGCGAGTTTTTTCTAAGG
JMSF019A13+ AATTAGATCAAACTCTATCTTTATAAGGCAGCTCCGTAGAAAAGCGAGTTTTTTCTAAGG
                      ____________________________________________________________
consensus AATTAGATCAAACTCTATCTTTATAAGGCAGCTCCGTAGAAAAGCGAGTTTTTTCTAAGG
 
. : . : . : . : . : . :
JMFF023N11+ GAAGAACGATGAGTTATTTCAAATTGTCACCAACCTCATTTCACGTAAGAAGGACGAAAT
JMFF009A09+ GAAGAACGATGAGTTATTTCAAATTGTCACCAACCTCATTTCACGTAAGAAGGACGAAAT
JMSF029L03+ GAAGAACGATGAGTTATTTCAAATTGTCACCAACCTCATTTCACGTAAGAAGGACGAAAT
JMSF019A13+ GAAGAACGATGAGTTATTTCAAATTGTCACCAACCTCATTTCACGTAAGAAGGACGAAAT
JMSF018M05+ TTATTTCAAATTGTCACCAACCTCATTTCACGTAAGAANGACGAAAT
                      ____________________________________________________________
consensus GAAGAACGATGAGTTATTTCAAATTGTCACCAACCTCATTTCACGTAAGAAGGACGAAAT
 
. : . : . : . : . : . :
JMFF023N11+ GGCATCTATTTCTTTCCCCTTCAGTGAGACTTTAGTTGCAACCCTTTTAACTAAAGAGCA
JMFF009A09+ GGCATCTATTTCTTTCCCCTTCAGTGAGACTTTAGTTGCAACCCTTTTAACTAAAGAGCA
JMSF029L03+ GGCATCTATTTCTTTCCCCTTCAGTGAGACTTTAGTTGCAACCCTTTTAACTAAAGAGCA
JMSF019A13+ GGCATCTATTTCTTTCCCCTTCAGTGAGACTTTAGTTGCAACCCTTTTAACTAAAGAGCA
JMSF018M05+ GGCATCTATTTCTTTCCCCNTCAGTGAGACTTTAGTTGCAACCCTTTTAACTAAAGAGCA
                      ____________________________________________________________
consensus GGCATCTATTTCTTTCCCCTTCAGTGAGACTTTAGTTGCAACCCTTTTAACTAAAGAGCA
 
. : . : . : . : . : . :
JMFF023N11+ TAAATAACTTATAGAATGCCAAGAGCGGAAAATTTATCTACCATTTGAGAAGATTCTACT
JMFF009A09+ TAAATAACTTATAGAATGCCAAGAGCGGAAAATTTATCTACCATTTGAGAAGATTCTACT
JMSF029L03+ TAAATAACTTATAGAATGCCAAGAGCGGAAAATTTATCTACCATTTGAGAAGATTCTACT
JMSF019A13+ TAAATAACTTATAGAATGCCAAGAGCGGAAAATTTATCTACCATTTGAGAAGATTCTACT
JMSF018M05+ TANATAACTTATAGAATGCCAAGAGCGGAAAATTTATCTACCATTTGAGAAGATTCTNCT
                      ____________________________________________________________
consensus TAAATAACTTATAGAATGCCAAGAGCGGAAAATTTATCTACCATTTGAGAAGATTCTACT
 
. : . : . : . : . : . :
JMFF023N11+ ATGCATAGTCTTCAGTAACAAGAACAACATGAAGAGGACTTCTCCAAAGCAAGATTATCC
JMFF009A09+ ATGCATAGTCTTCAGTAACAAGAACAACATGAAGAGGACTTCTCCAAAGCAAGATTATCC
JMSF029L03+ ATGCATAGTCTTCAGTAACAAGAACAACATGAAGAGGACTTCTCCAAAGCAAGATTATCC
JMSF019A13+ ATGCATAGTCTTCAGTAACAAGAACAACATGAAGAGGACTTCTCCAAAGCAAGATTATCC
JMSF018M05+ GTGCATNGTCTTCAGTAACANGAACAACATGAAGNGGNCTTCTCCAAAGCAAGATNATCC
                      ____________________________________________________________
consensus ATGCATAGTCTTCAGTAACAAGAACAACATGAAGAGGACTTCTCCAAAGCAAGATTATCC
 
. : . : . : . : . : . :
JMFF023N11+ AATTGTGATTTAGCAGTCTCCGAGAAAAAAAGTTCC
JMFF009A09+ AATTGTGATTTAGCAGTCTCCGAGAAAAAAAGTTCC
JMSF029L03+ AATTGTGATTTAGCAGTCTCCGAGAAAAAAAGTTCCCGACAAACTGAAACTGCC
JMSF019A13+ AATTGTGATTTAGCAGTCTCCGAGAAAAAAAGTTCCCGACAAACTGAAACTGCC
JMSF018M05+ AANTGTGATTTAGCAGTNTCCGAGAAAAAAAGTTCCNGACAAACTGAAACTGCCCATCAT
                      ____________________________________________________________
consensus AATTGTGATTTAGCAGTCTCCGAGAAAAAAAGTTCCCGACAAACTGAAACTGCCCATCAT
 
. : . : . : . : . : . :
JMSF018M05+ ACGAATCNTTAANTTCNNCTTTACGAAATCAAAGCGTCTCCCAAAAAAATCAAATTTTCC
                      ____________________________________________________________
consensus ACGAATCNTTAANTTCNNCTTTACGAAATCAAAGCGTCTCCCAAAAAAATCAAATTTTCC