Previous Contig 005770:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF018L20Sequence431005770 (2)pir|T02074|T020743e-494-coumarate-CoA ligase (EC 6.2.1.12) - common tobacco>gb:TOB4CCAL_1725353 Nicoti133022839
JMSF029P12Sequence599005770 (2)pir|T02074|T020743e-724-coumarate-CoA ligase (EC 6.2.1.12) - common tobacco>gb:TOB4CCAL_1725353 Nicoti

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF029P12+ CGGCATGTCCCTCTCGTCCGCCCCCGCCAGCTCCGAGAAATGCAGGCACCCCTCCCGCG
                      ____________________________________________________________
consensus CGGCATGTCCCTCTCGTCCGCCCCCGCCAGCTCCGAGAAATGCAGGCACCCCTCCCGCG
 
. : . : . : . : . : . :
JMSF029P12+ CCGAGTCGATGCACGCGACCTTCACGCCGTGATCCCGCGCGTAGTCCTTAACTCTTTCCA
                      ____________________________________________________________
consensus CCGAGTCGATGCACGCGACCTTCACGCCGTGATCCCGCGCGTAGTCCTTAACTCTTTCCA
 
. : . : . : . : . : . :
JMSF029P12+ CGTAGCACGCCTGCGTCACGATGAGCTTCGCGTTGGACGCCTTGGCCTGCTTCACCACCT
JMSF018L20+ CTTCACCACNT
                      ____________________________________________________________
consensus CGTAGCACGCCTGCGTCACGATGAGCTTCGCGTTGGACGCCTTGGCCTGCTTCACCACCT
 
. : . : . : . : . : . :
JMSF029P12+ CCGCCGCCGTGAAAAGCGGGTTGGCCATCGTCGACAGGGCGCCGCGGAAGGACGCGCCGA
JMSF018L20+ CCGCCGCCGTGAAAAGCGGGTTGGCCATCGTCGACAGGGCGCCGCGGAAGGACGCGCCGA
                      ____________________________________________________________
consensus CCGCCGCCGTGAAAAGCGGGTTGGCCATCGTCGACAGGGCGCCGCGGAAGGACGCGCCGA
 
. : . : . : . : . : . :
JMSF029P12+ GGAACGCGAACACGAACTCCGGCGAGTTTGGCAGCAAGATCATGATGGTGTCCCCCTGCT
JMSF018L20+ GGAACGCGAACACGAACTCCGGCGAGTTTGGCAGCAAGATCATGATGGTGTCCCCCTGCT
                      ____________________________________________________________
consensus GGAACGCGAACACGAACTCCGGCGAGTTTGGCAGCAAGATCATGATGGTGTCCCCCTGCT
 
. : . : . : . : . : . :
JMSF029P12+ TGATCCCTTGCTTATCCAGCCCCGCCGCAACTCGCCATGACGTCAGTTCCACCTCCGCGT
JMSF018L20+ TGATCCCTTGCTTATCCAGCCCCGCCGCAACTCGCCGTGACGTCAGTTCCACCTCCGCGT
                      ____________________________________________________________
consensus TGATCCCTTGCTTATCCAGCCCCGCCGCAACTCGCCGTGACGTCAGTTCCACCTCCGCGT
 
. : . : . : . : . : . :
JMSF029P12+ AAGTATAGATTTTCTCGGTGGCGCCGTCGATCAGGCACGGCCGCTCCTTGAACTCCGAGA
JMSF018L20+ AAGTATAGATTTTCTCGGTGGCGCCGTCGATCAGGCACGGCCGCTCCTTGAACTCCGAGA
                      ____________________________________________________________
consensus AAGTATAGATTTTCTCGGTGGCGCCGTCGATCAGGCACGGCCGCTCCTTGAACTCCGAGA
 
. : . : . : . : . : . :
JMSF029P12+ TGTTCTCAAAGCAATAAGAATGCAGAGGGAGGTGTTTAGGGATGTAGATATCCGGGAGCT
JMSF018L20+ TGTTCTCAAAGCAATAAGAATGCAGAGGGAGGTGTTTAGGGATGTAGATATCCGGGAGCT
                      ____________________________________________________________
consensus TGTTCTCAAAGCAATAAGAATGCAGAGGGAGGTGTTTAGGGATGTAGATATCCGGGAGCT
 
. : . : . : . : . : . :
JMSF029P12+ TCGACCGGAAAATGACGTCACCTTGCACACTTTTGGTTTCCATTATTTATCTGATCTGTA
JMSF018L20+ TCGACCGGAAAATGACGTCACCTTGCACACTTTTGGTTTCCATTATTTATCTGATCTGTA
                      ____________________________________________________________
consensus TCGACCGGAAAATGACGTCACCTTGCACACTTTTGGTTTCCATTATTTATCTGATCTGTA
 
. : . : . : . : . : . :
JMSF029P12+ GAGAGAGAAGATTGGACACACCAACAAAAAACATAAATTTCTTGAGCGCTGGGTGTCCTC
JMSF018L20+ GAGAGAGAAAATTGGACACACCAACAAAAAACATAAATTTCTTGAGCGCTGGGTGTCCTC
                      ____________________________________________________________
consensus GAGAGAGAAGATTGGACACACCAACAAAAAACATAAATTTCTTGAGCGCTGGGTGTCCTC