Previous Contig 005767:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017M07Sequence343005767 (40)
JMFF026A16Sequence288005767 (40)gb:AF005359_17607932e-33Nicotiana glutinosa RNA-binding protein mRNA, complete cds.157021247gb:AP004094_18376075e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ16
JMFF026B03Sequence512005767 (40)gb:AF005359_17607934e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFF026M06Sequence496005767 (40)gb:AF005359_17607931e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFF032C21Sequence566005767 (40)gb:AF005359_17607935e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.697005767 (40)gb:AF005359_17607937e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFF038G24Sequence462005767 (40)gb:AF005359_17607939e-37Nicotiana glutinosa RNA-binding protein mRNA, complete cds.702005767 (40)gb:AF005359_17607937e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN003H18Sequence519005767 (40)gb:AF005359_17607934e-09Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN003N23Sequence612005767 (40)gb:AF005359_17607935e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN003P12Sequence627005767 (40)gb:AF005359_17607936e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN004A17Sequence636005767 (40)gb:AF005359_17607936e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN004O03Sequence606005767 (40)gb:AF005359_17607935e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN005F04Sequence596005767 (40)gb:AF005359_17607935e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN006C20Sequence607005767 (40)gb:AF005359_17607935e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN006L14Sequence591005767 (40)gb:AF005359_17607935e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN007J01Sequence618005767 (40)gb:AF005359_17607936e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN007K18Sequence605005767 (40)gb:AF005359_17607936e-35Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN008I12Sequence614005767 (40)gb:AF005359_17607936e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN009P03Sequence617005767 (40)gb:AF005359_17607936e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN010B05Sequence627005767 (40)gb:AB007819_15103242e-35Citrus unshiu gene for glycine-rich RNA-binding protein, complete cds.
JMFN010J08Sequence627005767 (40)gb:AF005359_17607936e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN015D11Sequence592005767 (40)gb:AF005359_17607935e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN016I14Sequence627005767 (40)gb:AB007819_15103242e-35Citrus unshiu gene for glycine-rich RNA-binding protein, complete cds.
JMFN020P03Sequence630005767 (40)gb:AF005359_17607936e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN029E04Sequence596005767 (40)gb:AF005359_17607935e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN032D05Sequence627005767 (40)gb:AF005359_17607936e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN033H09Sequence592005767 (40)gb:AF005359_17607935e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN035M21Sequence589005767 (40)gb:AF005359_17607935e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN042H17Sequence618005767 (40)gb:AF005359_17607936e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMFN044C21Sequence576005767 (40)gb:AF200322_17764543e-20Catharanthus roseus clone G3.6 putative glycine-rich RNA binding protein 3 (GRP-
JMFN046N13Sequence623005767 (40)gb:AF005359_17607936e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMSF009B21Sequence322005767 (40)gb:AF005359_17607934e-40Nicotiana glutinosa RNA-binding protein mRNA, complete cds.667005767 (40)gb:AF005359_17607937e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMSF018L05Sequence466005767 (40)gb:AB007819_15103241e-35Citrus unshiu gene for glycine-rich RNA-binding protein, complete cds.
JMSF018L12Sequence546005767 (40)gb:AF200322_17764545e-19Catharanthus roseus clone G3.6 putative glycine-rich RNA binding protein 3 (GRP-793011590 (2)gb:AP004187_18387279e-55Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ14
JMSF023M22Sequence682005767 (40)gb:AF005359_17607937e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.680005767 (40)gb:AF005359_17607937e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.
JMSF026I02Sequence648005767 (40)gb:AF005359_17607935e-35Nicotiana glutinosa RNA-binding protein mRNA, complete cds.739011030 (5)gb:AY087280_15723135e-64Arabidopsis thaliana clone 33544 mRNA, complete sequence.
JMSF050F05Sequence648005767 (40)gb:AF005359_17607936e-36Nicotiana glutinosa RNA-binding protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN003H18+ AAAATGC
JMFN044C21- ATGC
                      ____________________________________________________________
consensus AAAATGC
 
. : . : . : . : . : . :
rJMFF017M07- ATTCCTCGAGNAACTTTGT-AATACAGATTTACAAACAANTCG
JMFN003H18+ AAATCAACGTTTACATCATTCCTCGAG-AACTTTGTAAATACAGATTTACAAACAAATCG
JMFN044C21- AAATCAACGTTTACATCATTCCTCGAG-AACTTTGTAAATACAGATTTACAAACAAATCG
JMFN010J08+ AACAAATCG
rJMFF032C21- ATTCCTCGAG-AA-TTTGTAAATACAGATTTACAAACAAATCG
JMFN003P12+ GATTTACAAACAAATCG
JMSF050F05- AACTTTGTAAATACAGATTTACAAACAAATCG
JMSF026I02- AACTTTGTAAATACAGATTTACAAACAAATCG
JMFN016I14+ TAAATACAGATTTACAAACAAATCG
JMFN010B05+ TAAATACAGATTTACAAACAAATCG
JMSF018L12- AACTTTGTAAATACAGATTTACAAACAAATCG
rJMFF038G24- CATTCCTCGAG-AACTTTGTAAATACAGATTTACAAACAAATCG
rJMSF023M22- CAGATTTACAAACAAATCG
JMFN004A17+ ACAAATCG
rJMSF009B21- AACAAATCG
JMSF023M22+ ATACAGATTTACAAACAAATCG
                      ____________________________________________________________
consensus AAATCAACGTTTACATCATTCCTCGAG-AACTTTGTAAATACAGATTTACAAACAAATCG
 
. : . : . : . : . : . :
rJMFF017M07- AACCACAGATAACCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
JMFN003H18+ AACCACAGATAACCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
JMFN044C21- AACCACAGATAACCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
JMFN010J08+ AACCACAGATAACCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
JMFN003N23+ ACCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
rJMFF032C21- AACCACAGATAACCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
JMFN003P12+ AACCACAGATAACCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
JMSF050F05- AACCACAGATAACCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
JMSF026I02- AACCACAGATAACCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
JMFN016I14+ AACCACAGATAACCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
JMFN010B05+ AACCACAGATAACCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
JMSF018L12- AACCACAGATAACCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACN
rJMFF038G24- AACCACAGATAACCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
rJMSF023M22- AACCACAGATAACCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
JMFN006C20+ CGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
JMFN006L14+ GCAGACTTAAAGTAACACCAAACACC
JMFN004A17+ AACCACAGATAACCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
JMFN042H17+ CCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
JMFN020P03+ AGATAACCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
JMFN032D05+ CGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
JMFN029E04+ ACACGCAGACTAAAAGTAACACCAAACACC
JMFN046N13+ GGATAACCAGAACACGCAGACTAAAAGTAACACCAAACACC
JMFN007K18+ CAGACTTAAAGTAACACCAAACACC
JMFN015D11+ ACACCAAACACC
JMFN007J01+ ACCAGAACACGCAGACTTAAAGTAACACCAAACACC
JMFN009P03+ GAACACGCAGACTTAAAGTAACACCAAACACC
JMFN033H09+ TTAAAGTAACACCAAACACC
JMFN035M21+ AAAGTAACACCAAACACC
JMFN004O03+ CAGAACACGCAGACTTAAAGTAACACCAAACACC
rJMSF009B21- AACCACAGATAACCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
JMFN008I12+ CGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
JMFN005F04+ ACCAGAACACGCAGACTTAAAGTAACACCAAACACC
JMSF023M22+ AACCACAGATAACCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
                      ____________________________________________________________
consensus AACCACAGATAACCGAAACGGATAACCAGAACACGCAGACTTAAAGTAACACCAAACACC
 
. : . : . : . : . : . :
rJMFF017M07- ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN003H18+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN044C21- ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN010J08+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN003N23+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
rJMFF032C21- ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN003P12+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMSF050F05- ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMSF026I02- ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN016I14+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN010B05+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMSF018L12- ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCNGGGACAAAACATTAACC
rJMFF038G24- ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
rJMSF023M22- ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN006C20+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN006L14+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN004A17+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN042H17+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN020P03+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN032D05+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN029E04+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN046N13+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN007K18+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN015D11+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN007J01+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN009P03+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN033H09+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN035M21+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN004O03+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFF032C21+ TAACAGATCCAGGGACAAAACATTANCC
rJMSF009B21- ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN008I12+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMFN005F04+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
JMSF023M22+ ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
                      ____________________________________________________________
consensus ATAGCAGAAGGACCCTAACAAGATCTAATATCTAACAGATCCAGGGACAAAACATTAACC
 
. : . : . : . : . : . :
rJMFF017M07- ACGCAACANTAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN003H18+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN044C21- ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN010J08+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN003N23+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
rJMFF032C21- ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN003P12+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMSF050F05- ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMSF026I02- ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN016I14+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN010B05+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMSF018L12- ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
rJMFF038G24- ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFF026B03+ TCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFF026M06+ TCCCNTAGAGTAGC
rJMSF023M22- ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN006C20+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN006L14+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN004A17+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN042H17+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN020P03+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN032D05+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN029E04+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN046N13+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN007K18+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN015D11+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN007J01+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN009P03+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN033H09+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN035M21+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN004O03+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFF032C21+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
rJMSF009B21- ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN008I12+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMFN005F04+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
JMSF023M22+ ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
                      ____________________________________________________________
consensus ACGCAACAATAAAGCTAGATTAGTTCCTCCAGCTTCCATCATCGCCTCCCCTAGAGTAGC
 
. : . : . : . : . : . :
rJMFF017M07- GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN003H18+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN044C21- GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN010J08+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN003N23+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
rJMFF032C21- GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN003P12+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMSF050F05- GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMSF026I02- GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN016I14+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN010B05+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMSF018L12- GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
rJMFF038G24- GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFF038G24+ TTCCNTGCGGCCACCATAGCCGC
JMFF026B03+ GGTCACGTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFF026M06+ GGTCACCTCCGCNGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
rJMSF023M22- GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN006C20+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN006L14+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN004A17+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN042H17+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN020P03+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN032D05+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN029E04+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN046N13+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN007K18+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN015D11+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN007J01+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN009P03+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN033H09+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN035M21+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN004O03+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFF032C21+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
rJMSF009B21- GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN008I12+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMFN005F04+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMSF023M22+ GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
JMSF018L05+ TAGCCACCGCCTCCATAACCACCTTCCTTGCGGCCACCATAGCCGC
                      ____________________________________________________________
consensus GGTCACCTCCGCCGTAGCCACCGCCTCCATAACCACCTTCCCTGCGGCCACCATAGCCGC
 
. : . : . : . : . : . :
rJMFF017M07- CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN003H18+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN044C21- CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN010J08+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN003N23+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
rJMFF032C21- CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN003P12+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMSF050F05- CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMSF026I02- CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN016I14+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN010B05+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMSF018L12- CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
rJMFF038G24- CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFF038G24+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFF026B03+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFF026M06+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
rJMSF023M22- CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN006C20+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN006L14+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN004A17+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN042H17+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN020P03+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN032D05+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN029E04+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN046N13+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN007K18+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN015D11+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN007J01+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN009P03+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN033H09+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN035M21+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN004O03+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFF032C21+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
rJMSF009B21- CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN008I12+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMFN005F04+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMSF023M22+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
JMSF018L05+ CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
                      ____________________________________________________________
consensus CACCGCCGCCACCACCATAACCACCTTCCCTGCGGCCACCATAGCCGCCACCGCCTCCAC
 
. : . : . : . : . : . :
rJMFF017M07- C
JMFN003H18+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN044C21- CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN010J08+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN003N23+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
rJMFF032C21- CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN003P12+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMSF050F05- CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMSF026I02- CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN016I14+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN010B05+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMSF018L12- CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
rJMFF038G24- CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFF038G24+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFF026B03+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFF026M06+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
rJMSF023M22- CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN006C20+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN006L14+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN004A17+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN042H17+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN020P03+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN032D05+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN029E04+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN046N13+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN007K18+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN015D11+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN007J01+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN009P03+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN033H09+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN035M21+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN004O03+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFF032C21+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
rJMSF009B21- CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN008I12+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMFN005F04+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMSF009B21+ CGCCGCCGCCGNTTCCGCGAGACT
JMSF023M22+ CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
JMSF018L05+ CCTAACGACGTCCACCACGGAAACCGCCACCGCCGCNGCCGCCGCCGCTTCCGCGAGANT
                      ____________________________________________________________
consensus CCTCACGACGTCCACCACGGAAACCGCCACCGCCGCCGCCGCCGCCGCTTCCGCGAGACT
 
. : . : . : . : . : . :
JMFN003H18+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN044C21- GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN010J08+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN003N23+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
rJMFF032C21- GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN003P12+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMSF050F05- GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMSF026I02- GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCACTCAATAG
JMFN016I14+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN010B05+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMSF018L12- GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
rJMFF038G24- GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFF038G24+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFF026B03+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFF026M06+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFF026A16+ ACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
rJMSF023M22- GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN006C20+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN006L14+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN004A17+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN042H17+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN020P03+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN032D05+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN029E04+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN046N13+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN007K18+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN015D11+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN007J01+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN009P03+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN033H09+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN035M21+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN004O03+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFF032C21+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
rJMSF009B21- GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN008I12+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMFN005F04+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMSF009B21+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMSF023M22+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
JMSF018L05+ GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
                      ____________________________________________________________
consensus GAGCCTCGTTAACAGTTATGTTACGCCCGTCAAGAGACTGGCCGTTCATCCCCTCAATAG
 
. : . : . : . : . : . :
JMFN003H18+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAA
JMFN044C21- CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN010J08+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN003N23+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
rJMFF032C21- CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN003P12+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMSF050F05- CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMSF026I02- CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN016I14+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN010B05+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMSF018L12- CATCCTTCATTGCTTGCTCATNCTTGAATGTAACGAAGCCNAAACCTCTGGATCTACCGG
rJMFF038G24- CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFF038G24+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFF026B03+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFF026M06+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFF026A16+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
rJMSF023M22- CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN006C20+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN006L14+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN004A17+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN042H17+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN020P03+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN032D05+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN029E04+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN046N13+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN007K18+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN015D11+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN007J01+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN009P03+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN033H09+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN035M21+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN004O03+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFF032C21+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
rJMSF009B21- CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN008I12+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMFN005F04+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMSF009B21+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMSF023M22+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
JMSF018L05+ CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
                      ____________________________________________________________
consensus CATCCTTCATTGCTTGCTCATCCTTGAATGTAACGAAGCCAAAACCTCTGGATCTACCGG
 
. : . : . : . : . : . :
JMFN044C21- TCTCACGATCGTTGATGATCTTCGATTCGATGA
JMFN010J08+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFN003N23+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
rJMFF032C21- TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFN003P12+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMSF050F05- TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMSF026I02- TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFN016I14+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFN010B05+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMSF018L12- TCTCACGATCGTTGATGATCTTCGATTCGATGAC
rJMFF038G24- TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAACGAAGAGAACGCATCAT
JMFF038G24+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFF026B03+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFF026M06+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFF026A16+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
rJMSF023M22- TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFN006C20+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFN006L14+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFN004A17+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFN042H17+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFN020P03+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFN032D05+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFN029E04+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFN046N13+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFN007K18+ TCTAACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFN015D11+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFN007J01+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFN009P03+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFN033H09+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFN035M21+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFN004O03+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFF032C21+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
rJMSF009B21- TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFN008I12+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMFN005F04+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMSF009B21+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMSF023M22+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
JMSF018L05+ TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
                      ____________________________________________________________
consensus TCTCACGATCGTTGATGATCTTCGATTCGATGACCTCGCCGAAGGAAGAGAACGCATCAT
 
. : . : . : . : . : . :
JMFN010J08+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFN003N23+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
rJMFF032C21- GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFN003P12+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMSF050F05- GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMSF026I02- GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFN016I14+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFN010B05+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
rJMFF038G24- GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFF038G24+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFF026B03+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFF026M06+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFF026A16+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
rJMSF023M22- GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFN006C20+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFN006L14+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFN004A17+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFN042H17+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFN020P03+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFN032D05+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFN029E04+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFN046N13+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFN007K18+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFN015D11+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFN007J01+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFN009P03+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFN033H09+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFN035M21+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFN004O03+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFF032C21+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
rJMSF009B21- GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFN008I12+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMFN005F04+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMSF009B21+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMSF023M22+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
JMSF018L05+ GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
                      ____________________________________________________________
consensus GTAGAGAACTTTCAGTGGTGGCCCAGGCCAAACCACCAACGAAGCATCTGAACTCAACTT
 
. : . : . : . : . : . :
JMFN010J08+ CTGCCATGACTGAAAGGA
JMFN003N23+ CTGCCATGACTGAAAGGAGAAAA
rJMFF032C21- CTGCCATGACTGAAAGGAGAAAATACNAGCAGAAGCTAAAGACTAGAAGAGAAGAC
JMFN003P12+ CTGCCATGAC
JMSF050F05- CTGCCATGACTGAAAG
JMSF026I02- CTGCCATGACTGAAAG
JMFN016I14+ CT
JMFN010B05+ CT
rJMFF038G24- CTGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAAGACTAGAAGAGAAGACGA
JMFF038G24+ CTGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAAGACTAGAAGAGAAGACGA
JMFF026B03+ CTGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAAGACTAGAAGAGAAGACGAT
JMFF026M06+ CTGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAAGACTAGAAGAGAAGACGA
JMFF026A16+ CTGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAAGACTAGAAGAGAAGACGAT
rJMSF023M22- CTGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAAGACTAGAAGAGAAGACGATC
JMFN006C20+ CTGCCATGACTGAAAGGAGAAAATA
JMFN006L14+ CTGCCATGACTGAAAGGAGAAAATA
JMFN004A17+ CTGCCATGACTGAAAGGAGAAAATACAA
JMFN042H17+ CTGCCATGACTGAAAGGAGAAAATACAAGC
JMFN020P03+ CTGCCATGACTGAAAGGAGAAAATACAAGCAGAAGC
JMFN032D05+ CTGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAA
JMFN029E04+ CTGCCATGACTGAAAGGAGAAAATAC
JMFN046N13+ CTGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAAGA
JMFN007K18+ CTGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAA
JMFN015D11+ CTGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAA
JMFN007J01+ CTGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAAGA
JMFN009P03+ CTGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAAGACTA
JMFN033H09+ CTGCCATGACTGAAAGGAGAAAATACAAGCAG
JMFN035M21+ CTGCCATGACTGAAAGGAGAAAATACAAGCA
JMFN004O03+ CTGCCATGACTGAAAGGAGAAAATACAAGCAG
JMFF032C21+ CTGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAAGACTAGAAGAGAAGAC
rJMSF009B21- CTGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAAGACTAGAAGAGAAGACG
JMFN008I12+ CTGCCATGACTGAAAGGAGAAAATACA
JMFN005F04+ CTGCCATGACTGAAAGGAGA
JMSF009B21+ CTGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAAGACTAGAAGAGAAGACG
JMSF023M22+ CTGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAAGACTAGAAGAGAAGACGATC
JMSF018L05+ NTGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAAGACTAGAAGAGAAGACGATC
                      ____________________________________________________________
consensus CTGCCATGACTGAAAGGAGAAAATACAAGCAGAAGCTAAAGACTAGAAGAGAAGACGATC