Previous Contig 005761:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017K02Sequence573005761 (5)pir|B71408|B714082e-41probable acylaminoacyl-peptidase - Arabidopsis thaliana>gb:ATCHRIV39_1545221 Ara834009016 (5)pir|JC8016|JC80163e-63acylaminoacyl-peptidase (EC 3.4.19.1) - Arabidopsis thaliana>gb:AB109759_1526856
JMFS110E08Sequence627005761 (5)pir|B71408|B714089e-61probable acylaminoacyl-peptidase - Arabidopsis thaliana>gb:ATCHRIV39_1545221 Ara
JMSF018J05Sequence618005761 (5)pir|B71408|B714081e-45probable acylaminoacyl-peptidase - Arabidopsis thaliana>gb:ATCHRIV39_1545221 Ara739009016 (5)pir|JC8016|JC80161e-61acylaminoacyl-peptidase (EC 3.4.19.1) - Arabidopsis thaliana>gb:AB109759_1526856
JMSF037D05Sequence655005761 (5)gb:AE016959_10225763e-44Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AE01717009016 (5)gb:AE016959_10225756e-52Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AE01
JMSF050M23Sequence626005761 (5)gb:AE016959_10225767e-42Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AE01686009016 (5)gb:AE016959_10225751e-50Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AE01

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037D05+ TAT
                      ____________________________________________________________
consensus TAT
 
. : . : . : . : . : . :
JMSF050M23+ CAAGGAATAGGCTCNTCAGCAACATAGGCTATTA
JMFS110E08+ GAATGTCGGCTTGCAAGGAATAGGCTCCTCAGCAACATAGGCTATTA
JMSF037D05+ AACCAAAATTAGTGAATGTCGGCTTGCAAGGAATAGGCTCNTCAGCAACATAGGCTATTA
                      ____________________________________________________________
consensus AACCAAAATTAGTGAATGTCGGCTTGCAAGGAATAGGCTCCTCAGCAACATAGGCTATTA
 
. : . : . : . : . : . :
JMSF050M23+ GAGTTTCGTCAGAGTTCCACGAAATTCCCTCAAACCATCCATCTGAATATACAGTTCCAT
JMFS110E08+ GAGTTTCGTCAGAGTTCCACGAAATTCCCTCAAACCATCCATCTGAATATACAGTTCCAT
JMSF037D05+ GAGTTTCGTCAGAGTTCCACGAAATTCCCTCAAACCATCCATCTGAATATACAGTTCCAT
JMSF018J05+ CTGAATATACAGTTCCAT
                      ____________________________________________________________
consensus GAGTTTCGTCAGAGTTCCACGAAATTCCCTCAAACCATCCATCTGAATATACAGTTCCAT
 
. : . : . : . : . : . :
JMSF050M23+ GGATAGAACAAGGAATGCGAATTTCCTTTTCCACGTGAGAGGGCCCCCATATTTCAAAGT
JMFS110E08+ GGATAGAACAAGGAATGCGAATTTCCTTTTCCACGTGAGAGGGCCCCCATATTTCAAAGT
JMSF037D05+ GGATAGAACAAGGAATGCGAATTTCCTTTTCCACGTGAGAGGGCCCCCATATTTCAAAGT
JMFF017K02+ ATTTCCTTTTCCACGTGAGAGGGCCCCCATATTTCAAAGT
JMSF018J05+ GGATAGAACAAGGAATGCGAATTTCCTTTTCCACGTGAGAGGGCCCCCATATTTCAAAGT
                      ____________________________________________________________
consensus GGATAGAACAAGGAATGCGAATTTCCTTTTCCACGTGAGAGGGCCCCCATATTTCAAAGT
 
. : . : . : . : . : . :
JMSF050M23+ GAGTCGGTGAGCCATTTTCTGAATTACGAATAACAAGAAGCTTTGAACCTGAAGGAGATG
JMFS110E08+ GAGTCGGTGAGCCATTTTCTGAATTACGAATAACAAGAAGCTTTGAACCTGAAGGAGATG
JMSF037D05+ GAGTCGGTGAGCCATTTTCTGAATTACGAATAACAAGAAGCTTTGAACCTGAAGGAGATG
JMFF017K02+ GAGTCGGTGAGCCATTTTCTGAATTACGAATAACAAGAAGCTTTGAACCTGAAGGAGATG
JMSF018J05+ GAGTCGGTGAGCCATTTTCTGAATTACGAATAACAAGAAGCTTTGAACCTGAAGGAGATG
                      ____________________________________________________________
consensus GAGTCGGTGAGCCATTTTCTGAATTACGAATAACAAGAAGCTTTGAACCTGAAGGAGATG
 
. : . : . : . : . : . :
JMSF050M23+ GAACCATTGTAGAGACTCCAGCCATTTCAATTGGAAATGGAGCCCATTTAAAATTAACAG
JMFS110E08+ GAACCATTGTAGAGACTCCAGCCATTTCAATTGGAAATGGAGCCCATTTAAAATTAACAG
JMSF037D05+ GAACCATTGTAGAGACTCCAGCCATTTCAATTGGAAATGGAGCCCATTTAAAATTAACAG
JMFF017K02+ GAACCATTGTAGAGACTCCAGCCATTTCAATTGGAAATGGAGCCCATTTAAAATTAACAG
JMSF018J05+ GAACCATTGTAGAGACTCCAGCCATTTCAATTGGAAATGGAGCCCATTTAAAATTAACAG
                      ____________________________________________________________
consensus GAACCATTGTAGAGACTCCAGCCATTTCAATTGGAAATGGAGCCCATTTAAAATTAACAG
 
. : . : . : . : . : . :
JMSF050M23+ AACTGTCTGCTCCTTTTGTGATAGTGTTTGATAATAAATATCTCCTC--TTTGTTTTCCA
JMFS110E08+ AACTGTCTGCTCCTTTTGTGATAGTGTTTGATAATAAATATCTCCTCTTTTTGTTTTCCA
JMSF037D05+ AACTGTCTGCTCCTTTTGTGATAGTGTTTGATAATAAATATCTCCTC--TTTGTTTTCCA
JMFF017K02+ AACTGTCTGCTCCTTTTGTGATAGTGTTTGATAATAAATATCTCCTCTTTTTGTTTTCCA
JMSF018J05+ AACTGTCTGCTCCTTTTGTGATAGTGTTTGATAATAAATATCTCCTCTTTTTGTTTTCCA
                      ____________________________________________________________
consensus AACTGTCTGCTCCTTTTGTGATAGTGTTTGATAATAAATATCTCCTCTTTTTGTTTTCCA
 
. : . : . : . : . : . :
JMSF050M23+ AGAGATTTGGTTGGCTAATTAAGAACATGCCCTGGGAACCATTGCTAGAAGTGAAAGTCC
JMFS110E08+ AGAGATTTGGTTGGCTAATTAAGAACATGCCCTGGGAACCATTGCTAGAAGTGAAAGTCC
JMSF037D05+ AGAGATTTGGTTGGCTAATTAAGAACATGCCCTGGGAACCATTGCTAGAAGTGAAAGTCC
JMFF017K02+ AGAGATTTGGTTGGCTAATTAAGAACATGCCCTGGGAACCATTGCTAGAAGTGAAAGTCC
JMSF018J05+ AGAGATTTGGTTGGCTAATTAAGAACATGCCCTGGGAACCATTGCTAGAAGTGAAAGTCC
                      ____________________________________________________________
consensus AGAGATTTGGTTGGCTAATTAAGAACATGCCCTGGGAACCATTGCTAGAAGTGAAAGTCC
 
. : . : . : . : . : . :
JMSF050M23+ AAGCCTTGTCAACAATGGGGATATCTATAAATTCTTTGAGCAATTTAGATTGCGAAGAGT
JMFS110E08+ AAGCCTTGTCAACAATGGGGATATCTATAAATTCTTTGAGCAATTTAGATTGCGAAGAGT
JMSF037D05+ AAGCCTTGTCAACAATGGGGATATCTATAAATTCTTTGAGCAATTTAGATTGCGAAGAGT
JMFF017K02+ AAGCCTTGTCAACAATGGGGATATCTATAAATTCTTTGAGCAATTTAGATTGCGAAGAGT
JMSF018J05+ AAGCCTTGTCAACAATGGGGATATCTATAAATTCTTTGAGCAATTTAGATTGCGAAGAGT
                      ____________________________________________________________
consensus AAGCCTTGTCAACAATGGGGATATCTATAAATTCTTTGAGCAATTTAGATTGCGAAGAGT
 
. : . : . : . : . : . :
JMSF050M23+ ACTCTTCCTCGGAAGATGCATCTACGCCCAAAGGCAATCCTTTCGGGGGCTTGGTTTGAG
JMFS110E08+ ACTCTTCCTCGGAAGATGCATCTACGCCCAAAGGCAATCCTTTCGGGGGCTTGGTTTGAG
JMSF037D05+ ACTCTTCCTCGGAAGATGCATCTACGCCCAAAGGCAATCCTTTCGGGGGCTTGGTTTGAG
JMFF017K02+ ACTCTTCCTCGGAAGATGCATCTACGCCCAAAGGCAATCCTTTCGGGGGCTTGGTTTGAG
JMSF018J05+ ACTCTTCCTCGGAAGATGCATCTACGCCCAAAGGCAATCCTTTCGGGGGCTTGGTTTGAG
                      ____________________________________________________________
consensus ACTCTTCCTCGGAAGATGCATCTACGCCCAAAGGCAATCCTTTCGGGGGCTTGGTTTGAG
 
. : . : . : . : . : . :
JMSF050M23+ GGTTTTCCATAGCAAAACTAGCTGAAAAGTATCTAGACGGAGGAGGGAAGGGTCCGGCGG
JMFS110E08+ GGTTTTCCATAGCAAAACTAGCTGAAAAGTATCTAGACGGAGGAGGGAAGGGTCCGGCGG
JMSF037D05+ GGTTTTCCATAGCAAAACTAGCTGAAAAGTATCTAGACGGAGGAGGGAAGGGTCCGGCGG
JMFF017K02+ GGTTTTCCATAGCAAAACTAGCTGAAAAGTATCTAGACGGAGGAGGGAAGGGTCCGGCGG
JMSF018J05+ GGTTTTCCATAGCAAAACTAGCTGAAAAGTATCTAGACGGAGGAGGGAAGGGTCCGGCGG
                      ____________________________________________________________
consensus GGTTTTCCATAGCAAAACTAGCTGAAAAGTATCTAGACGGAGGAGGGAAGGGTCCGGCGG
 
. : . : . : . : . : . :
JMSF050M23+ AGAGAGGGTTGACGAGACGAATTGAAGGAGAGCGAGGAAAGAATTGCGGGCG
JMFS110E08+ AGAGAGGGTTGACGAGACGAATTGAAGGAGAGCGAGGAAA
JMSF037D05+ AGAGAGGGTTGACGAGACGAATTGAAGGAGAGCGAGGAAAGAATTGCGGGCG
JMFF017K02+ AGAGAGGGTTGACGAGACGAATTGAAGGAGAGCGAGGAAAGAATTGCGGGCGCGAGAGAA
JMSF018J05+ AGAGAGGGTTGACGAGACGAATTGAAGGAGAGCGAGGAAAGAATTGCGGGCGCGAGAGAA
                      ____________________________________________________________
consensus AGAGAGGGTTGACGAGACGAATTGAAGGAGAGCGAGGAAAGAATTGCGGGCGCGAGAGAA
 
. : . : . : . : . : . :
JMFF017K02+ ATGGGTTGAAGCGTCTCTGCCAGTGAGTAAGTGAAGAAGTCCAGTAGCAGTCC
JMSF018J05+ ATGGGTTGAAGCGTCTCTGCCAGTGAGTAAGTGAAGAAGTCCAGTAGCAGTCCAACAGTC
                      ____________________________________________________________
consensus ATGGGTTGAAGCGTCTCTGCCAGTGAGTAAGTGAAGAAGTCCAGTAGCAGTCCAACAGTC