Previous Contig 005760:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF040N15Sequence480005760 (3)gb:LTU73105_16854316e-50Liriodendron tulipifera high-pI laccase (LAC2-3) mRNA, complete cds.757010090 (3)gb:AB015475_15125944e-69Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MMN10.>gb:BT015359_1642
JMSF018I23Sequence366005760 (3)gb:LTU73106_16854329e-26Liriodendron tulipifera high-pI laccase (LAC2-4) mRNA, complete cds.739010090 (3)gb:LTU73105_16854315e-80Liriodendron tulipifera high-pI laccase (LAC2-3) mRNA, complete cds.
JMSF049D09Sequence681005760 (3)gb:LTU73106_16854328e-88Liriodendron tulipifera high-pI laccase (LAC2-4) mRNA, complete cds.748010090 (3)gb:AB015475_15125944e-71Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MMN10.>gb:BT015359_1642

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF049D09+ TCCGGGAAGTCCATTGATGGTATAGGCATCA
                      ____________________________________________________________
consensus TCCGGGAAGTCCATTGATGGTATAGGCATCA
 
. : . : . : . : . : . :
JMSF049D09+ GAGACATTTGGACCTCCACCTGTTTGTAAAGCTTGGCTAATTATTGCCTCAGTATCACCA
                      ____________________________________________________________
consensus GAGACATTTGGACCTCCACCTGTTTGTAAAGCTTGGCTAATTATTGCCTCAGTATCACCA
 
. : . : . : . : . : . :
JMSF049D09+ TTGAACCATTCACCAAAGATGATGGGTACTTCCTTGTAGGGTTTGACGAATGGGTAAGAA
                      ____________________________________________________________
consensus TTGAACCATTCACCAAAGATGATGGGTACTTCCTTGTAGGGTTTGACGAATGGGTAAGAA
 
. : . : . : . : . : . :
JMSF049D09+ ACATTTTTCTTTGGGAGGATAATAATAGGACCATGAAGTGTTGCTCTAAGCCAAGAGATG
JMFF040N15+ AAGAGATG
                      ____________________________________________________________
consensus ACATTTTTCTTTGGGAGGATAATAATAGGACCATGAAGTGTTGCTCTAAGCCAAGAGATG
 
. : . : . : . : . : . :
JMSF049D09+ TGTGCATGCCAAAATAAAGTCCCTCTTTGTCCAACAATGGTGTACTTATACACATAGCTT
JMFF040N15+ TGTGCATGCCAAAATAAAGTCCCTCTTTGTCCAACAATGGTGTACTTATACACATAGCTT
                      ____________________________________________________________
consensus TGTGCATGCCAAAATAAAGTCCCTCTTTGTCCAACAATGGTGTACTTATACACATAGCTT
 
. : . : . : . : . : . :
JMSF049D09+ TGTCCAGTTTGAATGGGACATTGCGTTATGTATGCTGGTCCATCTGCCCATCCGCTACGA
JMFF040N15+ TGTCCAGTTTGAATGGGACATTGCGTTATGTATGCTGGTCCATCTGCCCATCCGCTACGA
JMSF018I23+ CGA
                      ____________________________________________________________
consensus TGTCCAGTTTGAATGGGACATTGCGTTATGTATGCTGGTCCATCTGCCCATCCGCTACGA
 
. : . : . : . : . : . :
JMSF049D09+ AGTTGCCGAATCCCATGCCAGTGAATTGAAATATTATTAGCAACATGATTATTGACTTTT
JMFF040N15+ AGTTGCCGAATCCCATGCCAGTGAATTGAAATATTATTAGCAACATGATTATTGACTTTT
JMSF018I23+ AGTTGCCGAATTCCATGCCAGTGAATCGAAATATTGTTAGCAACATGATTATTGACTTTT
                      ____________________________________________________________
consensus AGTTGCCGAATCCCATGCCAGTGAATTGAAATATTATTAGCAACATGATTATTGACTTTT
 
. : . : . : . : . : . :
JMSF049D09+ ATTAGTAGGCGGTCGCCCTCCCTAGCTAGAATTGGAGGTCCCGGATATTTGCCATTGACC
JMFF040N15+ ATTAGTAGGCGGTCGCCCTCCCTAGCTAGAATTGGAGGTCCCGGATATTTGCCATTGACC
JMSF018I23+ ATTAATAGGCGATCACCCTCCCTAGCTAGAATCGGAGGTCCTGGAAATTTGCCATTGACC
                      ____________________________________________________________
consensus ATTAGTAGGCGGTCGCCCTCCCTAGCTAGAATTGGAGGTCCCGGATATTTGCCATTGACC
 
. : . : . : . : . : . :
JMSF049D09+ GTAACAATGCTCTTTGTGTGGCACAGTCGAGTCACATTTTGCATGGTGACATTAAACTCG
JMFF040N15+ GTAACAATGCTCTTTGTGTGGCACAGTCGAGTCACATTTTGCATGGTGACATTAAACTCG
JMSF018I23+ GTAACCATGCTCTTTGTGTGGCACAGTCGAGTCACATTTTGCATGGTGACATTGAACTCA
                      ____________________________________________________________
consensus GTAACAATGCTCTTTGTGTGGCACAGTCGAGTCACATTTTGCATGGTGACATTAAACTCG
 
. : . : . : . : . : . :
JMSF049D09+ TAGTGCCTAGTTAAGGCTTGTGCAGGTTGAGGAAGGAGAAACAAAGCTAGAAGTGGAAGT
JMFF040N15+ TAGTGCCTAGTTAAGGCTTGTGCAGGTTGAGGAAGGAGAAACAAAGCTAGAAGTGGAAGT
JMSF018I23+ TAGTGCCTAGTTTCGGCTTGTGCATGTTGAGGAAGGAGACACAAAGCTAGAAGTGGAAGT
                      ____________________________________________________________
consensus TAGTGCCTAGTTAAGGCTTGTGCAGGTTGAGGAAGGAGAAACAAAGCTAGAAGTGGAAGT
 
. : . : . : . : . : . :
JMSF049D09+ ATGATTGCCATTGAAAACATTTGTGGAAGATATGTTGCAGCCATGACGAT
JMFF040N15+ ATGATTGCCATTGAAAACATTTGTGGAAGATATGTTGCAGCCATGACGAT
JMSF018I23+ ATGATTGCCATTGAAAATATTTGTGAAAAATATGTTGCAGCCATTACGATATAATAATGT
                      ____________________________________________________________
consensus ATGATTGCCATTGAAAACATTTGTGGAAGATATGTTGCAGCCATGACGATATAATAATGT
 
. : . : . : . : . : . :
JMSF018I23+ GTAGTTGGAGAAGATCAGAGTGCTTATAATTAATTATATATGTTGAGAGATTGTTGAATC
                      ____________________________________________________________
consensus GTAGTTGGAGAAGATCAGAGTGCTTATAATTAATTATATATGTTGAGAGATTGTTGAATC