Previous Contig 005757:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS044G06Sequence642005757 (4)
JMFS143A01Sequence634005757 (4)
JMFS161A03Sequence602005757 (4)
JMSF018I12Sequence506005757 (4)805022825gb:AB026654_15172966e-40Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MVE11.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS161A03+ AGGTTCAGTCCCCACCCTTGCCTGTACACTTTACGCACAAGGAGTCTTCATCAC
                      ____________________________________________________________
consensus AGGTTCAGTCCCCACCCTTGCCTGTACACTTTACGCACAAGGAGTCTTCATCAC
 
. : . : . : . : . : . :
JMFS161A03+ CTCTGATCAGTTAAGGTCTCCCAATGACCCCAAGATTCAAACCACAAGGGTCTTCATCAC
JMFS143A01+ AGGTCTCCCAATGACCCCAAGATTCAAACCACAAGGGTCTTCATCAC
                      ____________________________________________________________
consensus CTCTGATCAGTTAAGGTCTCCCAATGACCCCAAGATTCAAACCACAAGGGTCTTCATCAC
 
. : . : . : . : . : . :
JMFS161A03+ CTTTGATGAGTTAAGATCTCCTAATGACCCTCAAGATTCCCATGAGATTCGAACCACAAG
JMFS143A01+ CTTTGATGAGTTAAGATCTCCTAATGACCCTCAAGATTCCCATGAGATTCGAACCACAAG
JMFS044G06+ ATGAGTTAAGATCTCCTAATGACCCTCAAGATTCCCATGAGATTCGAACCACAAG
                      ____________________________________________________________
consensus CTTTGATGAGTTAAGATCTCCTAATGACCCTCAAGATTCCCATGAGATTCGAACCACAAG
 
. : . : . : . : . : . :
JMFS161A03+ GGTGATCTTCCCACACTGTCGCTGAAACGAGACTTTTTAAGGTGATTGGTCAAACTAAAC
JMFS143A01+ GGTGATCTTCCCACACTGTCGCTGAAACGAGACTTTTTAAGGTGATTGGTCAAACTAAAC
JMFS044G06+ GGTGATCTTCCCACACTGTCGCTGAAACGAGACTTTTTAAGGTGATTGGTCAAACTAAAC
                      ____________________________________________________________
consensus GGTGATCTTCCCACACTGTCGCTGAAACGAGACTTTTTAAGGTGATTGGTCAAACTAAAC
 
. : . : . : . : . : . :
JMFS161A03+ TGAGCTAGCCTTGCTGGCAAGTCTTTCTTTTATCATCTGCAAAGAGACATTTTCCATTTT
JMFS143A01+ TGAGCTAGCCTTGCTGGCAAGTCTTTCTTTTATCATCTGCAAAGAGACATTTTCCATTTT
JMFS044G06+ TGAGCTAGCCTTGCTGGCAAGTCTTTCTTTTATCATCTGCAAAGAGACATTTTCCATTTT
JMSF018I12+ ATCTGCAAAGAGACATTTTCCATTTT
                      ____________________________________________________________
consensus TGAGCTAGCCTTGCTGGCAAGTCTTTCTTTTATCATCTGCAAAGAGACATTTTCCATTTT
 
. : . : . : . : . : . :
JMFS161A03+ TCTTCCCAAAAAAATGAAATTTGTACTAAATTTTACACCATCTAGCCATCTAATATGACT
JMFS143A01+ TCTTCCCAAAAAAATGAAATTTGTACTAAATTTTACACCATCTAGCCATCTAATATGACT
JMFS044G06+ TCTTCCCAAAAAAATGAAATTTGTACTAAATTTTACACCATCTAGCCATCTAATATGACT
JMSF018I12+ TCTTCCCAAAAAAATGAAATTTGTACTAAATTTTACACCATCTAGCCATCTAATATGACT
                      ____________________________________________________________
consensus TCTTCCCAAAAAAATGAAATTTGTACTAAATTTTACACCATCTAGCCATCTAATATGACT
 
. : . : . : . : . : . :
JMFS161A03+ AAGCCAGATGCCAAAATCTTACATATCCATTTGCTACCAGTGAAATGACACACTACTAGT
JMFS143A01+ AAGCCAGATGCCAAAATCTTACATATCCATTTGCTACCAGTGAAATGACACACTACTAGT
JMFS044G06+ AAGCCAGATGCCAAAATCTTACATATCCATTTGCTACCAGTGAAATGACACACTACTAGT
JMSF018I12+ AAGCCAGATGCCAAAATCTTACATATCCATTTGCTACCAGTGAAATGACACACTACTAGT
                      ____________________________________________________________
consensus AAGCCAGATGCCAAAATCTTACATATCCATTTGCTACCAGTGAAATGACACACTACTAGT
 
. : . : . : . : . : . :
JMFS161A03+ AACATTCTCCTTTCTTAATTCTTACTGTGCTGCAGGAACCACCAGAGGCAACCGACATAA
JMFS143A01+ AACATTCTCCTTTCTTAATTCTTACTGTGCTGCAGGAACCACCAGAGGCAACCGACATAA
JMFS044G06+ AACATTCTCCTTTCTTAATTCTTACTGTGCTGCAGGAACCACCAGAGGCAACCGACATAA
JMSF018I12+ AACATTCTCCTTTCTTAATTCTTACTGTGCTGCAGGAACCACCAGAGGCAACCGACATAA
                      ____________________________________________________________
consensus AACATTCTCCTTTCTTAATTCTTACTGTGCTGCAGGAACCACCAGAGGCAACCGACATAA
 
. : . : . : . : . : . :
JMFS161A03+ CATGAAGAAAATGTTTCTGTATTTATACATGGGATTGATTGATCTGTGTCACTCTCCTTC
JMFS143A01+ CATGAAGAAAATGTTTCTGTATTTATACATGGGATTGATTGATCTGTGTCACTCTCCTTC
JMFS044G06+ CATGAAGAAAATGTTTCTGTATTTATACATGGGATTGATTGATCTGTGTCACTCTCCTTC
JMSF018I12+ CATGAAGAAAATGTTTCTGTATTTATACATGGGATTGATTGATCTGTGTCACTCTCCTTC
                      ____________________________________________________________
consensus CATGAAGAAAATGTTTCTGTATTTATACATGGGATTGATTGATCTGTGTCACTCTCCTTC
 
. : . : . : . : . : . :
JMFS161A03+ TACTTCAAGCCATTTCAGAGATTTTATCAACTGTTTGGTGGCATAAATCCCAATTGATTT
JMFS143A01+ TACTTCAAGCCATTTCAGAGATTTTATCAACTGTTTGGTGGCATAAATCCCAATTGATTT
JMFS044G06+ TACTTCAAGCCATTTCAGAGATTTTATCAACTGTTTGGTGGCATAAATCCCAATTGATTT
JMSF018I12+ TACTTCAAGCCATTTCAGAGATTTTATCAACTGTTTGGTGGCATAAATCCCAATTGATTT
                      ____________________________________________________________
consensus TACTTCAAGCCATTTCAGAGATTTTATCAACTGTTTGGTGGCATAAATCCCAATTGATTT
 
. : . : . : . : . : . :
JMFS161A03+ AGACATCA
JMFS143A01+ AGACATCATTCTTGAATGACACTGACCAGTTAGTTCGGTGTGAATGAAGATTGTTATTGG
JMFS044G06+ AGACATCATTCTTGAATGACACTGACCAGTTAGTTCGGTGTGAATGAAGATTGTTATTGG
JMSF018I12+ AGACATCATTCTTGAATGACACTGACCAGTTAGTTCGGTGTGAATGAAGATTGTTATTGG
                      ____________________________________________________________
consensus AGACATCATTCTTGAATGACACTGACCAGTTAGTTCGGTGTGAATGAAGATTGTTATTGG
 
. : . : . : . : . : . :
JMFS143A01+ AAACTAGAAATTGAAATACGAAGAAGAAATAGGAAAAGGAAGAGAAC
JMFS044G06+ AAACTAGAAATTGAAATACGAAGAAGAAATAGGAAAAGGAAGAGAACAAAAAAATGGTTG
JMSF018I12+ AAACTAGAAATTGAAATACGAAGAAGAAATAGGAAAAGGAAGAGAACAAAAAAATGGTTG
                      ____________________________________________________________
consensus AAACTAGAAATTGAAATACGAAGAAGAAATAGGAAAAGGAAGAGAACAAAAAAATGGTTG
 
. : . : . : . : . : . :
JMFS044G06+ GTTAAGGAAGGGACAAGAAAATAAATGCTGAGGGAACATGTTAGTCA
JMSF018I12+ GTTAAGGAAGGGACAAGAAAATAAATGCTGAGGGAACATGTTAGTCAACATGTTCTCCGC
                      ____________________________________________________________
consensus GTTAAGGAAGGGACAAGAAAATAAATGCTGAGGGAACATGTTAGTCAACATGTTCTCCGC