Previous Contig 005756:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018C04Sequence559005756 (3)pir|E84758|E847589e-21probable pyruvate dehydrogenase E1 beta subunit [imported] - Arabidopsis thalian766012023 (3)gb:AY087792_1572819e-104Arabidopsis thaliana clone 38439 mRNA, complete sequence.
JMSF018H23Sequence247005756 (3)662012023 (3)gb:AY087792_15728191e-99Arabidopsis thaliana clone 38439 mRNA, complete sequence.
JMSF027L22Sequence651005756 (3)pir|E84758|E847581e-37probable pyruvate dehydrogenase E1 beta subunit [imported] - Arabidopsis thalian691012023 (3)gb:AY087792_1572819e-108Arabidopsis thaliana clone 38439 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF027L22+ GGAGTGTCGAGGACCCTTAAATCACCGTACTTTTCTGCCAGTCCTTTAGTG
                      ____________________________________________________________
consensus GGAGTGTCGAGGACCCTTAAATCACCGTACTTTTCTGCCAGTCCTTTAGTG
 
. : . : . : . : . : . :
JMFF018C04+ TCACACACACACTCGGATCT
JMSF027L22+ ACCTTGTATGAACCTCCATAATGACCGACATCTTCACCCATCACACACACACTCGGATCT
                      ____________________________________________________________
consensus ACCTTGTATGAACCTCCATAATGACCGACATCTTCACCCATCACACACACACTCGGATCT
 
. : . : . : . : . : . :
JMFF018C04+ CTTTCCATCTCCTCATCAAGCCCTTCCCGAAGGGCTTCAAAAAGCAAAAGTTCATGCCCC
JMSF027L22+ CTTTCCATCTCCCCATCAAGCCCTTCCCGAAGGGCTTCAAAAAGCAAAAGTTCATGCCCC
                      ____________________________________________________________
consensus CTTTCCATCTCCTCATCAAGCCCTTCCCGAAGGGCTTCAAAAAGCAAAAGTTCATGCCCC
 
. : . : . : . : . : . :
JMFF018C04+ GGTTTGGACGATGTAGAAGCAGCTGCACCATCAGCCTTCGTCGCAACAGCACTAGTAACC
JMSF027L22+ GGTTTGGACGATGTAGAAGCAGCTGCACCATCAGCCTTCGTCGCAACAGCACTAGTAACC
                      ____________________________________________________________
consensus GGTTTGGACGATGTAGAAGCAGCTGCACCATCAGCCTTCGTCGCAACAGCACTAGTAACC
 
. : . : . : . : . : . :
JMFF018C04+ AATTGCTCAGCTCTCTTTCCATTCCAGCTCAAACCAGAGCTTAATCTCCCATCAGATCTA
JMSF027L22+ AATTGCTCAGCTCTCTTTCCATTCCAGCTCAAACCAGAGCTTAATCTCCCATCAGATCTA
                      ____________________________________________________________
consensus AATTGCTCAGCTCTCTTTCCATTCCAGCTCAAACCAGAGCTTAATCTCCCATCAGATCTA
 
. : . : . : . : . : . :
JMFF018C04+ ATCACAAAAAAGGTTCCTTTCCTCCCTGGGAAAGATCTGCGAGAAGAGATGTGAAACTTC
JMSF027L22+ ATCACAAAAAAGGTTCCTTTCCTCCCTGGGAAAGATCTGCGAGAAGAGATGTGAAACTTC
                      ____________________________________________________________
consensus ATCACAAAAAAGGTTCCTTTCCTCCCTGGGAAAGATCTGCGAGAAGAGATGTGAAACTTC
 
. : . : . : . : . : . :
JMFF018C04+ TTGGAATCTAAGGAATTGGGCGAGGAGAGAGTAGTAGCGGCCCCAATTGCTTGAATAATA
JMSF027L22+ TTGGAATCTAAGGAATTGGGCGAGGAGAGAGTAGTAGCGGCCCCAATTGCTTGAATAATA
JMSF018H23+ AATAATA
                      ____________________________________________________________
consensus TTGGAATCTAAGGAATTGGGCGAGGAGAGAGTAGTAGCGGCCCCAATTGCTTGAATAATA
 
. : . : . : . : . : . :
JMFF018C04+ GCAGCCATTTCTTCTTCTTCTTCTTCTTATGCTTCCTGAATTGGTGATGAAGAATTCCAA
JMSF027L22+ GCAGCCATTTCTTCTTCTTCTTCTTCTTATGCTTCCTGAATTGGTGATGAAGAATTCCAA
JMSF018H23+ GCAGCCATTTCTTCTTCTTCTTCTTCTTATGCTTCCTGAATTGGTGATGAAGAATTCCAA
                      ____________________________________________________________
consensus GCAGCCATTTCTTCTTCTTCTTCTTCTTATGCTTCCTGAATTGGTGATGAAGAATTCCAA
 
. : . : . : . : . : . :
JMFF018C04+ GTACAGCAATACTACCTACATTCAAGAAATAGCGCAGACTTTGTGTGGGGAAGAAAGTAT
JMSF027L22+ GTACAGCAATACTACCTACATTCAAGAAATAGCGCAGACTTTGTGTGGGGAAGAAAGTAT
JMSF018H23+ GTACAGCAATACTACCTACATTCAAGAAATAGCGCAGACTTTGTGTGGGGAAGAAAGTAT
                      ____________________________________________________________
consensus GTACAGCAATACTACCTACATTCAAGAAATAGCGCAGACTTTGTGTGGGGAAGAAAGTAT
 
. : . : . : . : . : . :
JMFF018C04+ ATAGAGATTGATAGAAAGTGGCGTGGTTTCATAGATAGAAAGAGTGGGAAGGGCGGCGGA
JMSF027L22+ ATAGAGATTGATAGAAAGTGGCGTGGTTTCATAGATAGAAAGAGTGGGAAGGGCGGCGGA
JMSF018H23+ ATAGAGATTGATAGAAAGTGGCGTGGTTTCATAGATAGAAAGAGTGGGAAGGGCGGCGGA
                      ____________________________________________________________
consensus ATAGAGATTGATAGAAAGTGGCGTGGTTTCATAGATAGAAAGAGTGGGAAGGGCGGCGGA
 
. : . : . : . : . : . :
JMFF018C04+ CAAAGCGAGGTGTAGGAGAGGTCGGGGCAGAAACTTTCATTTTTGTTCTGAGTTTCGG
JMSF027L22+ CAAAGCGAGGTGTAGGAGAGGTCGGGGCAGAAACTTTCATTTTTGTTCTGAGTTTCGG
JMSF018H23+ CAAAGCGAGGTGTAGGAGAGGTCGGGGCAGAAACTTTCATTTTTGTTNTGAGTTTCGGCC
                      ____________________________________________________________
consensus CAAAGCGAGGTGTAGGAGAGGTCGGGGCAGAAACTTTCATTTTTGTTCTGAGTTTCGGCC