Previous Contig 005747:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019L10Sequence542005747 (10)gb:AY053419_15629325e-35Arabidopsis thaliana T5E21.14/T5E21.14 mRNA, complete cds.>gb:AY093961_1575467 A387021101
JMFF039O03Sequence542005747 (10)gb:AY053419_15629325e-35Arabidopsis thaliana T5E21.14/T5E21.14 mRNA, complete cds.>gb:AY093961_1575467 A
JMFS055D01Sequence642005747 (10)gb:AY053419_15629327e-91Arabidopsis thaliana T5E21.14/T5E21.14 mRNA, complete cds.>gb:AY093961_1575467 A
JMSF007I03Sequence255005747 (10)sp|P04706|GLU2_MAIZE6e-05Glutelin 2 precursor (Zein-gamma) (27 kDa zein) (Alcohol-soluble reduced gluteli769000477 (9)gb:AY053419_15629327e-48Arabidopsis thaliana T5E21.14/T5E21.14 mRNA, complete cds.>gb:AY093961_1575467 A
JMSF007P06Sequence306005747 (10)gb:AY053419_15629321e-13Arabidopsis thaliana T5E21.14/T5E21.14 mRNA, complete cds.>gb:AY093961_1575467 A774000477 (9)gb:AY053419_15629322e-53Arabidopsis thaliana T5E21.14/T5E21.14 mRNA, complete cds.>gb:AY093961_1575467 A
JMSF008P06Sequence291005747 (10)gb:AY053419_15629324e-11Arabidopsis thaliana T5E21.14/T5E21.14 mRNA, complete cds.>gb:AY093961_1575467 A652000477 (9)gb:AY053419_15629321e-42Arabidopsis thaliana T5E21.14/T5E21.14 mRNA, complete cds.>gb:AY093961_1575467 A
JMSF010D13Sequence310005747 (10)gb:AY053419_15629321e-13Arabidopsis thaliana T5E21.14/T5E21.14 mRNA, complete cds.>gb:AY093961_1575467 A655000477 (9)gb:AY053419_15629322e-36Arabidopsis thaliana T5E21.14/T5E21.14 mRNA, complete cds.>gb:AY093961_1575467 A
JMSF018F24Sequence487005747 (10)gb:AY053419_15629327e-33Arabidopsis thaliana T5E21.14/T5E21.14 mRNA, complete cds.>gb:AY093961_1575467 A775000477 (9)gb:AY053419_15629328e-39Arabidopsis thaliana T5E21.14/T5E21.14 mRNA, complete cds.>gb:AY093961_1575467 A
JMSF025M03Sequence646005747 (10)gb:AB017069_15134633e-61Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ8.657000477 (9)gb:AY053419_15629322e-36Arabidopsis thaliana T5E21.14/T5E21.14 mRNA, complete cds.>gb:AY093961_1575467 A
JMSF039G22Sequence684005747 (10)gb:AB017069_15134631e-66Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ8.831000477 (9)gb:AC134229_17416459e-71Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1081D05, complete se

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS055D01+ A
                      ____________________________________________________________
consensus A
 
. : . : . : . : . : . :
JMFS055D01+ GAACCAATGGATCTCCAGGTGCTGTGGCAATGCAGAGATTTGCGAGAACTTTTCCATCCT
                      ____________________________________________________________
consensus GAACCAATGGATCTCCAGGTGCTGTGGCAATGCAGAGATTTGCGAGAACTTTTCCATCCT
 
. : . : . : . : . : . :
JMFS055D01+ TTTCTCAAAAGGAGTATTTGTTTCCTTCCATTTCACAGAGTACATGAAATCTACATCAAG
                      ____________________________________________________________
consensus TTTCTCAAAAGGAGTATTTGTTTCCTTCCATTTCACAGAGTACATGAAATCTACATCAAG
 
. : . : . : . : . : . :
JMFS055D01+ TTCCTTATCCATAGTGATGTCAACCATGGCACTAGGATCAGCTCTTGCAATGATCTCAAC
JMSF039G22+ GATCAGCTCTTGCAATGATCTCAAC
                      ____________________________________________________________
consensus TTCCTTATCCATAGTGATGTCAACCATGGCACTAGGATCAGCTCTTGCAATGATCTCAAC
 
. : . : . : . : . : . :
JMFS055D01+ GATTTGATCTTTATTGTAGAAGATCTCAAAATGGAGATGCTTAAATAAGTAATACTTGTA
JMSF039G22+ GATTTGATCTTTATTGTAGAAGATCTCAAAATGGAGATGCTTAAATAAGTAATACTTGTA
JMSF025M03+ TTGTAGAAGATCTCAAAATGGAGATGCTTAAATAAGTAATACTTGTA
                      ____________________________________________________________
consensus GATTTGATCTTTATTGTAGAAGATCTCAAAATGGAGATGCTTAAATAAGTAATACTTGTA
 
. : . : . : . : . : . :
JMFS055D01+ TTCGCTGGGGTCAGATTTCCCTTCTTTGTCAACCTTGCCAATATAACCCCAAACTGGCAA
JMSF039G22+ TTCGCTGGGGTCAGATTTCCCTTCTTTGTCAACCTTGCCAATATAACCCCAAACTGGCAA
JMFF039O03+ GCCAATATAACCCCAAACTGGCAA
JMFF019L10+ GCCAATATAACCCCAAACTGGCAA
JMSF025M03+ TTCGCTGGGGTCAGATTTCCCTTCTTTGTCAACCTTGCCAATATAACCCCAAACTGGCAA
                      ____________________________________________________________
consensus TTCGCTGGGGTCAGATTTCCCTTCTTTGTCAACCTTGCCAATATAACCCCAAACTGGCAA
 
. : . : . : . : . : . :
JMFS055D01+ GTCATCATAGTACATTTGGAAATAGTAGTCCTCTGCAACTGCATGTCGGAATTTCTCCAC
JMSF039G22+ GTCATCATAGTACATTTGGAAATAGTAGTCCTCTGCAACTGCATGTCGGAATTTCTCCAC
JMFF039O03+ GTCATCATAGTACATTTGGAAATAGTAGTCCTCTGCAACTGCATGTCGGAATTTCTCCAC
JMFF019L10+ GTCATCATAGTACATTTGGAAATAGTAGTCCTCTGCAACTGCATGTCGGAATTTCTCCAC
JMSF025M03+ GTCATCATAGTACATTTGGAAATAGTAGTCCTCTGCAACTGCATGTCGGAATTTCTCCAC
JMSF018F24+ TTCTCCAC
                      ____________________________________________________________
consensus GTCATCATAGTACATTTGGAAATAGTAGTCCTCTGCAACTGCATGTCGGAATTTCTCCAC
 
. : . : . : . : . : . :
JMFS055D01+ ATCACTCTTTGACAGTTTTTTCTTGCAAACTACCTCGGACTCTTTATCAGCTAAGAAATC
JMSF039G22+ ATCACTCTTTGACAGTTTTTTCTTGCAAACTACCTCGGACTCTTTATCAGCTAAGAAATC
JMFF039O03+ ATCACTCTTTGACAGTTTTTTCTTGCAAACTACCTCGGACTCTTTATCAGCTAAGAAATC
JMFF019L10+ ATCACTCTTTGACAGTTTTTTCTTGCAAACTACCTCGGACTCTTTATCAGCTAAGAAATC
JMSF025M03+ ATCACTCTTTGACAGTTTTTTCTTGCAAACTACCTCGGACTCTTTATCAGCTAAGAAATC
JMSF018F24+ ATCACTCTTTGACAGTTTTTTCTTGCAAACTACCTCGGACTCTTTATCAGCTAAGAAATC
                      ____________________________________________________________
consensus ATCACTCTTTGACAGTTTTTTCTTGCAAACTACCTCGGACTCTTTATCAGCTAAGAAATC
 
. : . : . : . : . : . :
JMFS055D01+ AAGTTTGTAAAGGGAATGAACTAAACGATCTCCATTCAATACCTCACCAAGTGCTTCTGA
JMSF039G22+ AAGTTTGTAAAGGGAATGAACTAAACGATCTCCATTCAATACCTCACCAAGTGCTTCTGA
JMFF039O03+ AAGTTTGTAAAGGGAATGAACTAAACGATCTCCATTCAATACCTCACCAAGTGCTTCTGA
JMFF019L10+ AAGTTTGTAAAGGGAATGAACTAAACGATCTCCATTCAATACCTCACCAAGTGCTTCTGA
JMSF025M03+ AAGTTTGTAAAGGGAATGAACTAAACGATCTCCATTCAATACCTCACCAAGTGCTTCTGA
JMSF018F24+ AAGTTTGTAAAGGGAATGAACTAAACGATCTCCATTCAATACCTCACCAAGTGCTTCTGA
                      ____________________________________________________________
consensus AAGTTTGTAAAGGGAATGAACTAAACGATCTCCATTCAATACCTCACCAAGTGCTTCTGA
 
. : . : . : . : . : . :
JMFS055D01+ TTTCTTTTCAACATTGGCTGGTGAACAGAAGGGCAAGTCATGGTACATGTAAGT-CTCGC
JMSF039G22+ TTTCTTTTCAACATTGGCTGGTGAACAGAAGGGCAAGTCATGGTACATGTAAGT-CTCGC
JMFF039O03+ TTTCTTTTCAACATTGGCTG----CAAGAATAACACAGCATCCT-CATGTTTGTGAAATC
JMFF019L10+ TTTCTTTTCAACATTGGCTG----CAAGAATAACACAGCATCCT-CATGTTTGTGAAATC
JMSF025M03+ TTTCTTTTCAACATTGGCTGGTGAACAGAAGGGCAAGTCATGGTACATGTAAGT-CTCGC
JMSF010D13+ TGAACAGAAGGNCAAGTCATGGTACATGTAAGT-CTCGC
JMSF008P06+ TGGTACATGTAAGT-CTCGC
JMSF007P06+ CAGAAGGGCAAGTCATGGTACATGTAAGT-CTCGC
JMSF018F24+ TTTCTTTTCAACATTGGCTGGTGAACAGAAGGGCAAGTCATGGTACATGTAAGT-CTCGC
                      ____________________________________________________________
consensus TTTCTTTTCAACATTGGCTGGTGAACAGAAGGGCAAGTCATGGTACATGTAAGT-CTCGC
 
. : . : . : . : . : . :
JMFS055D01+ TAGGGTTGTGAAAAGGGCCGACCTTGTTGGCGTACAGATGGACCTCATCTCCTTGCTTGT
JMSF039G22+ TAGGGTTGTGAAAAGGGCCGACCTTGTTGGCGTACAGATGGACCTCATCTCCTTGCTTGT
JMFF039O03+ TAGGGTTGTGAAAAGGGCCGACCTTGTTGGCGTACAGATGGACCTCATCTCCTTGCTTGT
JMSF007I03+ TGTTGGCGTACAGATGGACNTCATCTCCTTGCTTGT
JMFF019L10+ TAGGGTTGTGAAAAGGGCCGACCTTGTTGGCGTACAGATGGACCTCATCTCCTTGCTTGT
JMSF025M03+ TAGGGTTGTGAAAAGGGCCGACCTTGTTGGCGTACAGATGGACCTCATCTCCTTGCTTGT
JMSF010D13+ TAGGGTTGTGAAAAGGGCCGACCTTGTTGGCGTACAGATGGACCTCATCTCCTTGCTTGT
JMSF008P06+ TAGGGTTGTGAAAAGGGCCGACCTTGTTGGCGTACAGATGGACCTCATCTCCTTGCTTGT
JMSF007P06+ TAGGGTTGTGAAAAGGGCCGACCTTGTTGGCGTACAGATGGACCTCATCTCCTTGCTTGT
JMSF018F24+ TAGGGTTGTGAAAAGGGCCGACCTTGTTGGCGTACAGATGGACCTCATCTCCTTGCTTGT
                      ____________________________________________________________
consensus TAGGGTTGTGAAAAGGGCCGACCTTGTTGGCGTACAGATGGACCTCATCTCCTTGCTTGT
 
. : . : . : . : . : . :
JMFS055D01+ ACCTGTGATCCGACGCATCCGATCTCACAACCTCCGTTGCAG
JMSF039G22+ ACCTGTGATCCGACGCATCCGATCTCACAACCTCCGTTGCAGTGCCAAGCAGCAACACCG
JMFF039O03+ ACCTGTGATCCGACGCATCCGATCTCACAACCTCCGTTGCAGTGCCAAGCAGCAACACCG
JMSF007I03+ ACCTGTGATCCGACGCATCCGATCTCACAACCTCCGTTGCAGTGCCAAGCAGCAACACCG
JMFF019L10+ ACCTGTGATCCGACGCATCCGATCTCACAACCTCCGTTGCAGTGCCAAGCAGCAACACCG
JMSF025M03+ ACCTGTGATCCGACGCATCCGATCTCACAACCTCCGTTGCAGTGCCAAGCAGCAACACCG
JMSF010D13+ ACCTGTGATCCGACGCATCCGATCTCACAACCTCCGTTGCAGTGCCAAGCAGCAACACCG
JMSF008P06+ ACCTGTGATCCGACGCATCCGATCTCACAACCTCCGTTGCAGTGCCAAGCAGCAACACCG
JMSF007P06+ ACCTGTGATCCGACGCATCCGATCTCACAACCTCCGTTGCAGTGCCAAGCAGCAACACCG
JMSF018F24+ ACCTGTGATCCGACGCATCCGATCTCACAACCTCCGTTGCAGTGCCAAGCAGCAACACCG
                      ____________________________________________________________
consensus ACCTGTGATCCGACGCATCCGATCTCACAACCTCCGTTGCAGTGCCAAGCAGCAACACCG
 
. : . : . : . : . : . :
JMSF039G22+ CCAATACGACGGCGTAGTGGCGCATCGCCCTCCTCCTGTCCATCTCCCTCATTCCGGCAA
JMFF039O03+ CCAATACGACGGCGTAGTGGCGCATCGCCCTCCTCCTGTCCATCTCCCTCATTCCGGCAA
JMSF007I03+ CCAATACGACGGCGTAGTGGCGCATCGCCCTCCTCCTGTCCATCTCCCTCATTCCGGCAA
JMFF019L10+ CCAATACGACGGCGTAGTGGCGCATCGCCCTCCTCCTGTCCATCTCCCTCATTCCGGCAA
JMSF025M03+ CCAATACGACGGCGTAGTGGCGCATCGCCCTCCTCCTGTCCATCTCCCTCATTCCGGCAA
JMSF010D13+ CCAATACGACGGCGTAGTGGCGCATCGCCCTCCTCCTGTCCATCTCCCTCATTCCGGCAA
JMSF008P06+ CCAATACGACGGCGTAGTGGCGCATCGCCCTCCTCCTGTCCATCTCCCTCATTCCGGCAA
JMSF007P06+ CCAATACGACGGCGTAGTGGCGCATCGCCCTCCTCCTGTCCATCTCCCTCATTCCGGCAA
JMSF018F24+ CCAATACGACGGCGTAGTGGCGCATCGCCCTCCTCCTGTCCATCTCCCTCATTCCGGCAA
                      ____________________________________________________________
consensus CCAATACGACGGCGTAGTGGCGCATCGCCCTCCTCCTGTCCATCTCCCTCATTCCGGCAA
 
. : . : . : . : . : . :
JMSF039G22+ GTTGCTCACAACAGAGAGCTACAAAGTCAACAGAGACGAAGCAATCGCAAGTCCTCAGAG
JMFF039O03+ GTTGCTCACAACAGAGAGCTACAAAGTCAACAGAGACGAAGCAATCGCAAGTCCTCAGAG
JMSF007I03+ GTTGCTCACAACAGAGAGCTACAAAGTCAACAGAGACGAAGCAATCGCAAGTCCTCAGAG
JMFF019L10+ GTTGCTCACAACAGAGAGCTACAAAGTCAACAGAGACGAAGCAATCGCAAGTCCTCAGAG
JMSF025M03+ GTTGCTCACAACAGAGAGCTACAAAGTCAACAGAGACGAAGCAATCGCAAGTCCTCAGAG
JMSF010D13+ GTTGCTCACAACAGAGAGCTACAAAGTCAACAGAGACGAAGCAATCGCAAGTCCTCAGAG
JMSF008P06+ GTTGCTCACAACAGAGAGCTACAAAGTCAACAGAGACGAAGCAATCGCAAGTCCTCAGAG
JMSF007P06+ GTTGCTCACAACAGAGAGCTACAAAGTCAACAGAGACGAAGCAATCGCAAGTCCTCAGAG
JMSF018F24+ GTTGCTCACAACAGAGAGCTACAAAGTCAACAGAGACGAAGCAATCGCAAGTCCTCAGAG
                      ____________________________________________________________
consensus GTTGCTCACAACAGAGAGCTACAAAGTCAACAGAGACGAAGCAATCGCAAGTCCTCAGAG
 
. : . : . : . : . : . :
JMSF039G22+ ATACGAGAGAGAGATGGAGAGAGAATCAAGCAGAGAGTAGAGTGCAAAGTCCGACT
JMFF039O03+ ATACGAGAGAGAGATGGAGAGAGAATCAAGCAGAGAGTAGAGT
JMSF007I03+ ATACGAGAGAGAGATGGAGAGAGAATCAAGCAGAGAGT
JMFF019L10+ ATACGAGAGAGAGATGGAGAGAGAATCAAGCAGAGAGTAGAGT
JMSF025M03+ ATACGAGAGAGAGATGGAGAGAGAATCAAGCAGAGAGTAGAGTGCAAAGTCCGACT
JMSF010D13+ ATACGAGAGAGAGATGGAGAGAGAATCAAGC
JMSF008P06+ ATACGAGAGAGAGATGGAGAGAGAATCAAGC
JMSF007P06+ ATACGAGAGAGAGATGGAGAGAGAATCAAGC
JMSF018F24+ ATACGAGAGAGAGATGGAGAGAGAATCAAGCAGAGAGTAGAGTGCAAAGTCCGACTCATC
                      ____________________________________________________________
consensus ATACGAGAGAGAGATGGAGAGAGAATCAAGCAGAGAGTAGAGTGCAAAGTCCGACTCATC