Previous Contig 005745:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF018F04Sequence226005745 (2)pir|T04216|T042162e-16hypothetical protein T5C23.120 - Arabidopsis thaliana>gb:ATCHRIV32_1544934 Arabi763013539 (2)gb:AP005783_18577652e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN
JMSF044E15Sequence839005745 (2)pir|T04216|T042163e-82hypothetical protein T5C23.120 - Arabidopsis thaliana>gb:ATCHRIV32_1544934 Arabi782013539 (2)gb:AP005783_18577652e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044E15+ CCGCTTTATCCATGCAGGAGAGCACTTCGAGTGCTTTCTCCATGTTATTAGATCGAGCA
                      ____________________________________________________________
consensus CCGCTTTATCCATGCAGGAGAGCACTTCGAGTGCTTTCTCCATGTTATTAGATCGAGCA
 
. : . : . : . : . : . :
JMSF044E15+ AAGGGCGTCGATCAGAATTGTGTATGTCACTTTCGAAGGAGAAATGCCTCTCTCCTCCAT
                      ____________________________________________________________
consensus AAGGGCGTCGATCAGAATTGTGTATGTCACTTTCGAAGGAGAAATGCCTCTCTCCTCCAT
 
. : . : . : . : . : . :
JMSF044E15+ CTCGCGAANTAAATCAAGAACTCTCATTGGATTTTCAGCTTTAGAGAAACCTGCGATTAG
                      ____________________________________________________________
consensus CTCGCGAANTAAATCAAGAACTCTCATTGGATTTTCAGCTTTAGAGAAACCTGCGATTAG
 
. : . : . : . : . : . :
JMSF044E15+ AGCATTGTAAGTAATTAACGATGGAGCTAAACCGCAAGACTTCAACTGATTGAACAAGCT
                      ____________________________________________________________
consensus AGCATTGTAAGTAATTAACGATGGAGCTAAACCGCAAGACTTCAACTGATTGAACAAGCT
 
. : . : . : . : . : . :
JMSF044E15+ AAATGCTTTCTCGATCTTCCCAGCTTTGCTATACCCATCGATCAGAATGTTATAAGTAAT
                      ____________________________________________________________
consensus AAATGCTTTCTCGATCTTCCCAGCTTTGCTATACCCATCGATCAGAATGTTATAAGTAAT
 
. : . : . : . : . : . :
JMSF044E15+ CAGATTAGGAGTAAACCCATCACTCTTCATCCGACCAACCAATTTCTCTGCATCCATCAT
                      ____________________________________________________________
consensus CAGATTAGGAGTAAACCCATCACTCTTCATCCGACCAACCAATTTCTCTGCATCCATCAT
 
. : . : . : . : . : . :
JMSF044E15+ TCTTGTCTGCCGACATAACCCTCTAATTAAAGTGTTATAAGTAACAACATTGCATACAAC
                      ____________________________________________________________
consensus TCTTGTCTGCCGACATAACCCTCTAATTAAAGTGTTATAAGTAACAACATTGCATACAAC
 
. : . : . : . : . : . :
JMSF044E15+ CCCTCCATCACGCATTTCGTCAAACAATTGAAAAGCGGTGTCTATTCGACACTCACTGCA
                      ____________________________________________________________
consensus CCCTCCATCACGCATTTCGTCAAACAATTGAAAAGCGGTGTCTATTCGACACTCACTGCA
 
. : . : . : . : . : . :
JMSF044E15+ ATGAACATTGATCATAGAGCTGTAAGTATGTGTATCAGGGTATGTACCATCAATTTTCAT
                      ____________________________________________________________
consensus ATGAACATTGATCATAGAGCTGTAAGTATGTGTATCAGGGTATGTACCATCAATTTTCAT
 
. : . : . : . : . : . :
JMSF044E15+ CCTCTCATAAAGCTCAAAACCATCTCTTTCAAGCCCATTCTTGAAAAACCCATTGATCAA
                      ____________________________________________________________
consensus CCTCTCATAAAGCTCAAAACCATCTCTTTCAAGCCCATTCTTGAAAAACCCATTGATCAA
 
. : . : . : . : . : . :
JMSF044E15+ AACTGTGTAAGTGTACTGATTAGGAACAAGCCCCAATTCTGACATTCCATGAAACAACTC
JMSF018F04+ ACTGATTAGGAACAAGCCCCAATTCTGACATTCCATGAAACAACTC
                      ____________________________________________________________
consensus AACTGTGTAAGTGTACTGATTAGGAACAAGCCCCAATTCTGACATTCCATGAAACAACTC
 
. : . : . : . : . : . :
JMSF044E15+ CTTTGCCTTTTGAATATCACCATTCTTAACACCCATCTATCAAAGTGGTATATATAACAA
JMSF018F04+ CTTTGCCTTTTGAATATCACCATTCTTAACACCCATCTATCAAAGTGGTATATATAACAA
                      ____________________________________________________________
consensus CTTTGCCTTTTGAATATCACCATTCTTAACACCCATCTATCAAAGTGGTATATATAACAA
 
. : . : . : . : . : . :
JMSF044E15+ CATTTGGACACCAACCCATATCTTCCAACTGACCCAAAAACTCAAAACCCCTCTTCAAGT
JMSF018F04+ CATTTGGACACCAACCCATATCTTCCAACTGACCCAAAAACTCAAAACCCCTCTTCAAGT
                      ____________________________________________________________
consensus CATTTGGACACCAACCCATATCTTCCAACTGACCCAAAAACTCAAAACCCCTCTTCAAGT
 
. : . : . : . : . : . :
JMSF044E15+ CTCCATTGTCACAGCAACCCTTAATCACAATCCCAAAACTATACACATCCAAACCCAAGC
JMSF018F04+ CTCCATTGTCACAGCAACCCTTAATCACAATCCCAAAACTATACACATCCAAACCCAAGC
                      ____________________________________________________________
consensus CTCCATTGTCACAGCAACCCTTAATCACAATCCCAAAACTATACACATCCAAACCCAAGC