Previous Contig 005735:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF018B17Sequence231005735 (2)770012001 (3)pir|T48220|T482204e-78hypothetical protein T7H20.40 - Arabidopsis thaliana>gb:ATT7H20_1556414 Arabidop
JMSF032J24Sequence706005735 (2)pir|T48220|T482209e-50hypothetical protein T7H20.40 - Arabidopsis thaliana>gb:ATT7H20_1556414 Arabidop663012001 (3)pir|T48220|T482205e-73hypothetical protein T7H20.40 - Arabidopsis thaliana>gb:ATT7H20_1556414 Arabidop

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032J24+ AACAAGTGGTACATTTCCAATATTCCCTATTCCAATTTGTATAATA
                      ____________________________________________________________
consensus AACAAGTGGTACATTTCCAATATTCCCTATTCCAATTTGTATAATA
 
. : . : . : . : . : . :
JMSF032J24+ GTAAACTTGAAAAATGGATACGGTGGACGGACGATTGTTGCAACAACTAGACCTATTATG
                      ____________________________________________________________
consensus GTAAACTTGAAAAATGGATACGGTGGACGGACGATTGTTGCAACAACTAGACCTATTATG
 
. : . : . : . : . : . :
JMSF032J24+ GAGCCTGATATTGTGGCAATGACAACATTAACAGGGATAAACCACCACTGAAGCATCTTC
                      ____________________________________________________________
consensus GAGCCTGATATTGTGGCAATGACAACATTAACAGGGATAAACCACCACTGAAGCATCTTC
 
. : . : . : . : . : . :
JMSF032J24+ TCGAATGTGATTGCTTGCCCAAGTTGAGAGAATATCAGGCATGGGAGCAATAGTGAAAAG
                      ____________________________________________________________
consensus TCGAATGTGATTGCTTGCCCAAGTTGAGAGAATATCAGGCATGGGAGCAATAGTGAAAAG
 
. : . : . : . : . : . :
JMSF032J24+ ACCAACCCATTTAAAAGCTTTCTTCCATTTGCAGGCAAGATATTAACATACTTGGAAGCC
                      ____________________________________________________________
consensus ACCAACCCATTTAAAAGCTTTCTTCCATTTGCAGGCAAGATATTAACATACTTGGAAGCC
 
. : . : . : . : . : . :
JMSF032J24+ ATGAGAAATCCCAGGAAACACATCGTGAAAACTTTAGCTATAGGTAAGACTGCAATCTTG
                      ____________________________________________________________
consensus ATGAGAAATCCCAGGAAACACATCGTGAAAACTTTAGCTATAGGTAAGACTGCAATCTTG
 
. : . : . : . : . : . :
JMSF032J24+ ATAGAACCAAGCAAGGATGTCCCTCCACCTTGAGATTCTGTGAGAATCTCCATAAGCAAC
                      ____________________________________________________________
consensus ATAGAACCAAGCAAGGATGTCCCTCCACCTTGAGATTCTGTGAGAATCTCCATAAGCAAC
 
. : . : . : . : . : . :
JMSF032J24+ CTCTGCACCCTATCCATCATACTATGAAAAAATCTCTTAAACTCTCCCTAAGATGAAGTA
                      ____________________________________________________________
consensus CTCTGCACCCTATCCATCATACTATGAAAAAATCTCTTAAACTCTCCCTAAGATGAAGTA
 
. : . : . : . : . : . :
JMSF032J24+ ATTGGCTTTCCCGGTCACCCGAGGGGAAAAGGACCTGCTCTTAGTAGTAAGCCACCAGAA
JMSF018B17+ CCCGGTCACCCGAGGGGAAAAGGACCTGCTCTTAGTAGTAAGCCACCAGAA
                      ____________________________________________________________
consensus ATTGGCTTTCCCGGTCACCCGAGGGGAAAAGGACCTGCTCTTAGTAGTAAGCCACCAGAA
 
. : . : . : . : . : . :
JMSF032J24+ ACAATTCGCATACAATGTTCTCCAATCAAAACAACTGAATCCCAAACAGCTCAGATTCTT
JMSF018B17+ ACAATTCGCATACAATGTTCTCCAATCAAAACAACTGAATCCCAAACAGCTCAGATTCTT
                      ____________________________________________________________
consensus ACAATTCGCATACAATGTTCTCCAATCAAAACAACTGAATCCCAAACAGCTCAGATTCTT
 
. : . : . : . : . : . :
JMSF032J24+ CAGCCCAGAAACGCCAGATACTCCACCACCTAACCTTTATCCCCGTTAATACGTAAGGTC
JMSF018B17+ CAGCCCAGAAACGCCAGATACTCCACCACCTAACCTTTATCCCCGTTAATACGTAAGGTC
                      ____________________________________________________________
consensus CAGCCCAGAAACGCCAGATACTCCACCACCTAACCTTTATCCCCGTTAATACGTAAGGTC
 
. : . : . : . : . : . :
JMSF032J24+ TTGGCGAAAAGACTGGAGACGAATCTCGAATACTTGAGCTGCGGTTGGGACGATGAATTC
JMSF018B17+ TTGGCGAAAAGACTGGAGACGAATCTCGAATACTTGAGCTGCGGTTGGGACGATGAATTC
                      ____________________________________________________________
consensus TTGGCGAAAAGACTGGAGACGAATCTCGAATACTTGAGCTGCGGTTGGGACGATGAATTC