Previous Contig 005732:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013N18Sequence536005732 (5)gb:AK118927_18168777e-46Arabidopsis thaliana At1g67490 mRNA for putative alpha-glucosidase I, complete c718011997 (3)gb:AP003707_18321875e-74Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ14
JMFS159D01Sequence513005732 (5)gb:AK118927_18168772e-43Arabidopsis thaliana At1g67490 mRNA for putative alpha-glucosidase I, complete c
JMSF018A24Sequence255005732 (5)gb:AK118927_18168770.001Arabidopsis thaliana At1g67490 mRNA for putative alpha-glucosidase I, complete c719011997 (3)gb:AP003707_18321871e-63Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ14
JMSF033B23Sequence567005732 (5)gb:AK118927_18168772e-47Arabidopsis thaliana At1g67490 mRNA for putative alpha-glucosidase I, complete c709013435 (2)gb:AP003707_18321877e-66Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ14
JMSF042L17Sequence795005732 (5)gb:ATH278990_15522703e-71Arabidopsis thaliana gcs1 gene for alpha-glucosidase 1, exons 1-22.782013435 (2)gb:AP003707_18321871e-53Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ14

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF042L17+ TTGATTGACCATAGAAATAGCCAATTCCACCCAATGTGCTTGCAAGAGC
                      ____________________________________________________________
consensus TTGATTGACCATAGAAATAGCCAATTCCACCCAATGTGCTTGCAAGAGC
 
. : . : . : . : . : . :
JMSF042L17+ ATCCCTACCCACGGTCACAGAACCAGAATCAAGCTGGTCAGATAGATTATAGCATCTTTT
                      ____________________________________________________________
consensus ATCCCTACCCACGGTCACAGAACCAGAATCAAGCTGGTCAGATAGATTATAGCATCTTTT
 
. : . : . : . : . : . :
JMSF042L17+ GAACTTGCCATCAAATTCCTTCTGCTTCTCATTTAGTAGACTGGAGAGTGAGGCACCTGC
                      ____________________________________________________________
consensus GAACTTGCCATCAAATTCCTTCTGCTTCTCATTTAGTAGACTGGAGAGTGAGGCACCTGC
 
. : . : . : . : . : . :
JMSF042L17+ GAGATTGGTAAGACGCTCTTCAACTCTTGAATCTTGTAATCCAGTTCCAGAAACAAAAAC
                      ____________________________________________________________
consensus GAGATTGGTAAGACGCTCTTCAACTCTTGAATCTTGTAATCCAGTTCCAGAAACAAAAAC
 
. : . : . : . : . : . :
JMSF042L17+ AATATCAGCTTTGAAAGAAATCCTAGCAGAGATCTGGAAAACTAAAATATTTGAAGAGTC
                      ____________________________________________________________
consensus AATATCAGCTTTGAAAGAAATCCTAGCAGAGATCTGGAAAACTAAAATATTTGAAGAGTC
 
. : . : . : . : . : . :
JMSF042L17+ ATCCAATGTATCTGAAAGCTCCAAGCGACCAAAGTTTCTTGCTTTGACTCCCAGATCTGC
                      ____________________________________________________________
consensus ATCCAATGTATCTGAAAGCTCCAAGCGACCAAAGTTTCTTGCTTTGACTCCCAGATCTGC
 
. : . : . : . : . : . :
JMSF042L17+ TTGGACAAGGTCAGATAAATTGTGAATGTGAGGTGTCTTGAAACCAGAATAATGCATATC
                      ____________________________________________________________
consensus TTGGACAAGGTCAGATAAATTGTGAATGTGAGGTGTCTTGAAACCAGAATAATGCATATC
 
. : . : . : . : . : . :
JMSF042L17+ AAAATTATCCTCTGATTTTATATGGAGCTGCCAACCCCCAACATCACTATGAGATCCTAA
                      ____________________________________________________________
consensus AAAATTATCCTCTGATTTTATATGGAGCTGCCAACCCCCAACATCACTATGAGATCCTAA
 
. : . : . : . : . : . :
JMSF042L17+ CGCTATGGCAGAATCATGATTGCTGCCTATGGCTCCTCCACCCAATGTTAGAGCATTTCC
                      ____________________________________________________________
consensus CGCTATGGCAGAATCATGATTGCTGCCTATGGCTCCTCCACCCAATGTTAGAGCATTTCC
 
. : . : . : . : . : . :
JMSF042L17+ ACTCATCAACTTGTGCCTCAATTCGAGTTACCCAGTCTCCACCATACCCACTTCCAATTG
                      ____________________________________________________________
consensus ACTCATCAACTTGTGCCTCAATTCGAGTTACCCAGTCTCCACCATACCCACTTCCAATTG
 
. : . : . : . : . : . :
JMSF042L17+ CCTTAGACTTCAAAAAACTTGTTGTCAATGTCATTGTTTGGTCAACTAAAAGTTGGTGTC
JMFF013N18+ GGTGCC
JMSF033B23+ GTTTGGTCAACTAAAAGTTGGTGTC
                      ____________________________________________________________
consensus CCTTAGACTTCAAAAAACTTGTTGTCAATGTCATTGTTTGGTCAACTAAAAGTTGGTGTC
 
. : . : . : . : . : . :
JMSF042L17+ CATAGTCTCGTCCATTATGGTGTGTCCAACCATACGTTTTCAGATCATCTGAATCTTGGC
JMFS159D01+ CATTATGGTGTGTCCAACCATACGTTTTCAGATCATCTGAATCTTGGC
JMFF013N18+ CATAGTCTNGTCCATTATGGTGTGTCCAACCATACGTTTTCAGATCATCTGAATCTTGGC
JMSF033B23+ CATAGTCTCGTCCATTATGGTGTGTCCAACCATACGTTTTCAGATCATNTGAATCTTGGC
                      ____________________________________________________________
consensus CATAGTCTCGTCCATTATGGTGTGTCCAACCATACGTTTTCAGATCATCTGAATCTTGGC
 
. : . : . : . : . : . :
JMSF042L17+ AAACATGGCGCATGAAAAACCTTCCATCC-TTGCACCAATCCACATTAAACCAAAAACTA
JMFS159D01+ AAACATGGCGCATGAAAAACCTTCCATCCTTTGCACCAATCCACATTAAACCAAAAACTA
JMFF013N18+ AAACATGGCGCATGAAAAACCTTCCATCCTTTGCACCAATCCACATTAAACCAAAAACTA
JMSF033B23+ AAACATGGCGCATGAAAAACCTTCCATCCTTTGCACCAATCCACATTAAACCAAAAACTA
                      ____________________________________________________________
consensus AAACATGGCGCATGAAAAACCTTCCATCCTTTGCACCAATCCACATTAAACCAAAAACTA
 
. : . : . : . : . : . :
JMSF042L17+ CAGATTGTGGAGTCCTTGCACGTAT
JMFS159D01+ CAGATTGTGGAGTCCTTGCACGTATACCAAAATAAACTTGAGGCCTGTAAGTTCCCCAAT
JMFF013N18+ CAGATTGTGGAGTCCTTGCACGTATACCAAAATAAACTTGAGGCCTGTAAGTTCCCCAAT
JMSF033B23+ CAGATTGTGGAGTCCTTGCACGTATACCAAAATAAACTTGAGGCCTGTAAGTTCCCCAAT
                      ____________________________________________________________
consensus CAGATTGTGGAGTCCTTGCACGTATACCAAAATAAACTTGAGGCCTGTAAGTTCCCCAAT
 
. : . : . : . : . : . :
JMFS159D01+ ACAAGCTTTCTTTATGTTCTCCTTGAAACATCGGAAGATCCGTGAGTTTTGGAGCGGGAA
JMFF013N18+ ACAAGCTTTCTTTATGTTCTCCTTGAAACATCGGAAGATCCGTGAGTTTTGGAGCGGGAA
JMSF033B23+ ACAAGCTTTCTTTATGTTCTCCTTGAAACATCGGAAGATCCGTGAGTTTNGGAGCGGGAA
                      ____________________________________________________________
consensus ACAAGCTTTCTTTATGTTCTCCTTGAAACATCGGAAGATCCGTGAGTTTTGGAGCGGGAA
 
. : . : . : . : . : . :
JMFS159D01+ GTGGAGTGATAACCCGGGGAATTTGAGGAACTTCAGCCGGATTGACAAGGCGGTAAATGA
JMFF013N18+ GTGGAGTGATAACCCGGGGAATTTGAGGAACTTCAGCCGGATTGACAAGGCGGTAAATGA
JMSF033B23+ GTGGAGTGATAACCCGGGGAATTTGAGGAACTTCAGCCGGATTGACAAGGCGGTAAATGA
JMSF018A24+ CAAGGCGGTAAATGA
                      ____________________________________________________________
consensus GTGGAGTGATAACCCGGGGAATTTGAGGAACTTCAGCCGGATTGACAAGGCGGTAAATGA
 
. : . : . : . : . : . :
JMFS159D01+ CAATCAATGCGATCGAGAAGGAAATAACACCAAAACCTAACAGCAATTTGAGGTTCACAT
JMFF013N18+ CAATCAATGCGATCGAGAAGGAAATAACACCAAAACCTAAGAGGAATTTGAGGTTCACAT
JMSF033B23+ CAATCAATGCGATCGAGAAGGAAATAACACCAAAACCTAAGAGGAATTTGAGGTTCACAT
JMSF018A24+ CAATCAATGCGATCGAGAAGGAAATAACACCAAAACCTAAGAGGAATTTGAGGTTCACAT
                      ____________________________________________________________
consensus CAATCAATGCGATCGAGAAGGAAATAACACCAAAACCTAAGAGGAATTTGAGGTTCACAT
 
. : . : . : . : . : . :
JMFS159D01+ TGAGGATGCGAATTGAGCTTTGCTCCCTGCCTCTCCTTCGGACTTTCGGATTAGGTGTCG
JMFF013N18+ TGAGGATGCGAATTGAGCTTTGCTCCCTGCCTCTCCTTCGGACTTTCGGATTAGGTGTCG
JMSF033B23+ TGAGGATGCGAATTGAGCTTTGCTCCCTGCCTCTCCTTCGGACTTTCGGATTAGGTGTCG
JMSF018A24+ TGAGGATGCGAATTGAGCTTTGCTCCCTGCCTCTCCTTCGGACTTTCGGATTAGGTGTCG
                      ____________________________________________________________
consensus TGAGGATGCGAATTGAGCTTTGCTCCCTGCCTCTCCTTCGGACTTTCGGATTAGGTGTCG
 
. : . : . : . : . : . :
JMFS159D01+ CGCTACGGACTTCGCGATCGTCATCATCTTCCGACGCCGGCTTCGCCCTGCTCCGAGCTG
JMFF013N18+ CGCTACGGACTTCGCGATCGTCATCATCTTCCGACGCCGGCTTCGCCCTGCTCCGAGCTG
JMSF033B23+ CGCTACGGACTTCGCGATCGTCATCATCTTCCGACGCCGGCTTCGCCCTGCTCCGAGCTG
JMSF018A24+ CGCTACGGACTTCGCGATCGTCATCATCTTCCGACGCCGGCTTCGCCCTGCTCCGAGCTG
                      ____________________________________________________________
consensus CGCTACGGACTTCGCGATCGTCATCATCTTCCGACGCCGGCTTCGCCCTGCTCCGAGCTG
 
. : . : . : . : . : . :
JMFS159D01+ TTCTTCGAGAATTTCCGGTCATGTTGGTGTGCTGTGGTCTAAGGA
JMFF013N18+ TTCTTCGAGAATTTCCGGTCATGTTGGTGTGCTGTGGTCTAAGGA
JMSF033B23+ TTCTTCGAGAATTTCCGGTCATGTTGGTGTGCTGTGGTNTAAGGACCGGTCTGTAAC
JMSF018A24+ TTCTTCGAGAATTTCCGGTCATGTTGGTGTGCTGTGGTCTAAGGACCGGTCTGTAACATC
                      ____________________________________________________________
consensus TTCTTCGAGAATTTCCGGTCATGTTGGTGTGCTGTGGTCTAAGGACCGGTCTGTAACATC