Previous Contig 005722:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS056C05Sequence627005722 (5)
JMSF017O24Sequence226005722 (5)668022798gb:AP005546_18538927e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ10
JMSF040A13Sequence679005722 (5)744013265 (4)gb:AX765824_14746016e-71Sequence 33 from Patent WO03008440.>gb:AF283277_1783043 Arabidopsis thaliana pol
JMSF045H09Sequence752005722 (5)803013265 (4)gb:AP005546_18538923e-86Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ10
JMSF050B23Sequence621005722 (5)754013265 (4)gb:AX765824_14746013e-79Sequence 33 from Patent WO03008440.>gb:AF283277_1783043 Arabidopsis thaliana pol

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF045H09+ TGGCAGTGATTCTCTTTGCTTTCAACTGAGCTTTGC
                      ____________________________________________________________
consensus TGGCAGTGATTCTCTTTGCTTTCAACTGAGCTTTGC
 
. : . : . : . : . : . :
JMSF040A13+ GTCAGAGAAAGATTGTGAGGTTGCAAGCTTGTATCAC
JMFS056C05+ AGCTTGTATCAC
JMSF045H09+ AGTTGTGAGGGAGAAGGCTTTCCGTCAGAGAAAGATTGTGAGGTTGCAAGCTTGTATCAC
                      ____________________________________________________________
consensus AGTTGTGAGGGAGAAGGCTTTCCGTCAGAGAAAGATTGTGAGGTTGCAAGCTTGTATCAC
 
. : . : . : . : . : . :
JMSF040A13+ TATGTGCCTGCGTCTCATACTCTTAGCTTTGCAGATTCCGGCATTGCTGTGCGAGACTGG
JMSF050B23+ ATTCCGGCATTGCTGTGCGAGACTGG
JMFS056C05+ TATGTGCCTGCGTCTCATACTCTTAGCTNTGCAGATTCCGGCATTGCTGTGCGAGACTGG
JMSF045H09+ TATGTGCCTGCGTCTCATACTCTTAGCTTTGCAGATTCCGGCATTGCTGTGCGAGACTGG
                      ____________________________________________________________
consensus TATGTGCCTGCGTCTCATACTCTTAGCTTTGCAGATTCCGGCATTGCTGTGCGAGACTGG
 
. : . : . : . : . : . :
JMSF040A13+ GGGAGGAGAGACCCTTGCAGATTCCGGCGTTGATGCGCAGCGAGACTGGGGGAGGAGGGG
JMSF050B23+ GGGAGGAGAGACCCTTGCAGATTCCGGCGTTGATGCGCAGCGAGACTGGGGGAGGAGGGG
JMFS056C05+ GGGAGGAGAGACCCTTGCAGATTCCGGCGTTGATGCGCAGCGAGACTGGGGGAGGAGGGG
JMSF045H09+ GGGAGGAGAGACCCTTGCAGATTCCGGCGTTGATGCGCAGCGAGACTGGGGGAGGAGGGG
                      ____________________________________________________________
consensus GGGAGGAGAGACCCTTGCAGATTCCGGCGTTGATGCGCAGCGAGACTGGGGGAGGAGGGG
 
. : . : . : . : . : . :
JMSF040A13+ TAAATTCCAACTCTACAAGTCTCGTAGTCTGGTGGACTGCTGGCCGTGGAGTCGAGGGCT
JMSF050B23+ TAAATTCCAACTCTACAAGTCTCGTAGTCTGGTGGACTGCTGGCCGTGGAGTCGAGGGCT
JMFS056C05+ TAAATTCCAACTCTACAAGTCTCGTAGTCTGGTGGACTGCTGGCCGTGGAGTCGAGGGCT
JMSF045H09+ TAAATTCCAACTCTACAAGTCTCGTAGTCTGGTGGACTGCTGGCCGTGGAGTCGAGGGCT
                      ____________________________________________________________
consensus TAAATTCCAACTCTACAAGTCTCGTAGTCTGGTGGACTGCTGGCCGTGGAGTCGAGGGCT
 
. : . : . : . : . : . :
JMSF040A13+ GGTGGACTGGAGCAGACGACGGCGAACTGGAGAAGAGTAGAAGACTGGCCGCCGGTGGAT
JMSF050B23+ GGTGGACTGGAGCAGACGACGGCGAACTGGAGAAGAGTAGAAGACTGGCCGCCGGTGGAT
JMFS056C05+ GGTGGACTGGAGCAGACGACGGCGAACTGGAGAAGAGTAGAAGACTGGCCGCCGGTGGAT
JMSF045H09+ GGTGGACTGGAGCAGACGACGGCGAACTGGAGAAGAGTAGAAGACTGGCCGCCGGTGGAT
                      ____________________________________________________________
consensus GGTGGACTGGAGCAGACGACGGCGAACTGGAGAAGAGTAGAAGACTGGCCGCCGGTGGAT
 
. : . : . : . : . : . :
JMSF040A13+ TACTGAGCAGACGACGGACTGACGCAGAGCTGGAGAAGACTCGTGGACGACTGGACGGTG
JMSF050B23+ TACTGAGCAGACGACGGACTGACGCAGAGCTGGAGAAGACTCGTGGACGACTGGACGGTG
JMFS056C05+ TACTGAGCAGACGACGGACTGACGCAGAGCTGGAGAAGACTCGTGGACGACTGGACGGTG
JMSF045H09+ TACTGAGCAGACGACGGACTGACGCAGAGCTGGAGAAGACTCGTGGACGACTGGACGGTG
                      ____________________________________________________________
consensus TACTGAGCAGACGACGGACTGACGCAGAGCTGGAGAAGACTCGTGGACGACTGGACGGTG
 
. : . : . : . : . : . :
JMSF040A13+ GACCTCGTGGTGGCCGGCCGCCGGACGCCGGTGGAGCAGTGAGTAGACGACGGGCTGACG
JMSF050B23+ GACCTCGTGGTGGCCGGCCGCCGGACGCCGGTGGAGCAGTGAGTAGACGACGGGCTGACG
JMFS056C05+ GACCTCGTGGTGGCCGGCCGCCGGACGCCGGTGGAGCAGTGAGTAGACGACGGGCTGACG
JMSF045H09+ GACCTCGTGGTGGCCGGCCGCCGGACGCCGGTGGAGCAGTGAGTAGACGACGGGCTGACG
                      ____________________________________________________________
consensus GACCTCGTGGTGGCCGGCCGCCGGACGCCGGTGGAGCAGTGAGTAGACGACGGGCTGACG
 
. : . : . : . : . : . :
JMSF040A13+ GAGAGGTGAGGCCTGAGGGAGACGAGACGAGTCGCAGTCGGCAGTGCTCCGTAGTAACGA
JMSF050B23+ GAGAGGTGAGGCCTGAGGGAGACGAGACGAGTCGCAGTCGGCAGTGCT
JMFS056C05+ GAGAGGTGAGGCCTGAGGGAGACGAGACGAGTCGCAGTCGGCAGTGCTCCGTAGTAACGA
JMSF045H09+ GAGAGGTGAGGCCTGAGGGAGACGAGACGAGTCGCAGTCGGCAGTGCTCCGTAGTAACGA
                      ____________________________________________________________
consensus GAGAGGTGAGGCCTGAGGGAGACGAGACGAGTCGCAGTCGGCAGTGCTCCGTAGTAACGA
 
. : . : . : . : . : . :
JMSF040A13+ TCTTCNTGAGAGTNTGATAAGTGTGGAGTCTGGAATTGANGATCTCCTTCCTCCTCCTAA
JMFS056C05+ TCTTCCTGAGAGTTTGATAAGTGTGGAGTCTGGAATTGACGATCTCCTTCCTCCTCCTAA
JMSF045H09+ TCTTCCTGAGAGTTTGATAAGTGTGGAGTCTGGAATTGACGATCTCCTTCCTCCTCCTAA
JMSF017O24+ TGATAAGTGTGGAGTCTGGAATTGACGATCTCCTTCCTCCTCCTAA
                      ____________________________________________________________
consensus TCTTCCTGAGAGTTTGATAAGTGTGGAGTCTGGAATTGACGATCTCCTTCCTCCTCCTAA
 
. : . : . : . : . : . :
JMSF040A13+ CTCCGGCGGCGGCAGANGATGCCCTCCTTCCTCCTCCTAACTCTGGCGGCGGCAGACGAA
JMFS056C05+ CTCCGGCGGCGGCAGACGATGCCCTCCTTCCTCCTCCTAACTCTGGCGGCGGCAGACGAA
JMSF045H09+ CTCCGGCGGCGGCAGACGATGCCCTCCTTCCTCCTCCTAACTCTGGCGGCGGCAGACGAA
JMSF017O24+ CTCCGGCGGCGGCAGACGATGCCCTCCTTCCTCCTCCTAACTCTGGCGGCGGCAGACGAA
                      ____________________________________________________________
consensus CTCCGGCGGCGGCAGACGATGCCCTCCTTCCTCCTCCTAACTCTGGCGGCGGCAGACGAA
 
. : . : . : . : . : . :
JMSF040A13+ GCCCTACGTCCTCCTCCTAACTCCGGCGGCGGCAGACGAAGCCTTACTTCCTCCTCCTAA
JMFS056C05+ GCCCTACGTCCTCCTCCTAACTCCGGCGGCGGCAGACGAAGCCTTACTTCCTCCTCCTAA
JMSF045H09+ GCCCTACGTCCTCCTCCTAACTCCGGCGGCGGCAGACGAAGCCTTACTTCCTCCTCCTAA
JMSF017O24+ GCCCTACGTCCTCCTCCTAACTCCGGCGGCGGCAGACGAAGCCTTACTTCCTCCTCCTAA
                      ____________________________________________________________
consensus GCCCTACGTCCTCCTCCTAACTCCGGCGGCGGCAGACGAAGCCTTACTTCCTCCTCCTAA
 
. : . : . : . : . : . :
JMSF040A13+ CTCCGGCGGCGGCAGACGAAGCTCTCCTTTTGTCGCTTT
JMFS056C05+ CTCCGGCGGCGGCAG
JMSF045H09+ CTCCGGCGGCGGCAGACGAAGCTCTCCTTTTGTCGCTTTTCCTCCTCCTGCCTC
JMSF017O24+ CTCCGGCGGCGGCAGACGAAGCTCTCCTTTTGTCGCTTTTCCTCCTCCTGCCTCTATTCC
                      ____________________________________________________________
consensus CTCCGGCGGCGGCAGACGAAGCTCTCCTTTTGTCGCTTTTCCTCCTCCTGCCTCTATTCC