Previous Contig 005718:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN029J20Sequence599005718 (8)gb:AY365247_16028802e-79Cucumis sativus hypersensitive-induced response protein mRNA, complete cds.
JMFS062C03Sequence616005718 (8)gb:AY365247_16028803e-76Cucumis sativus hypersensitive-induced response protein mRNA, complete cds.
JMSF017N16Sequence504005718 (8)gb:AY365247_16028808e-54Cucumis sativus hypersensitive-induced response protein mRNA, complete cds.796005718 (8)gb:AP005508_18530728e-96Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P071
JMSF019J12Sequence519005718 (8)gb:AY365247_16028804e-67Cucumis sativus hypersensitive-induced response protein mRNA, complete cds.782005718 (8)gb:AP005508_18530725e-94Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P071
JMSF027A18Sequence635005718 (8)gb:AY365247_16028807e-73Cucumis sativus hypersensitive-induced response protein mRNA, complete cds.767005718 (8)gb:AP005508_18530721e-75Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P071

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF027A18- ATATCCCACAATGCATGTGTACATATTAACACGTGGATGATGGACATATGGC
                      ____________________________________________________________
consensus ATATCCCACAATGCATGTGTACATATTAACACGTGGATGATGGACATATGGC
 
. : . : . : . : . : . :
rJMSF027A18- ATACTCTAACTAAAAGTTTCAATATTAAGCACTCGAGCAATTACCTTTCGTCCAGACTAA
rJMSF019J12- GCACTCGAGC-ATTACCTTTCGTCCAGACTAA
rJMSF017N16- CCTTTCGTCC-GACTAA
                      ____________________________________________________________
consensus ATACTCTAACTAAAAGTTTCAATATTAAGCACTCGAGCAATTACCTTTCGTCCAGACTAA
 
. : . : . : . : . : . :
rJMSF027A18- AAACACAAATCCTAAAATCCATGGGAATATACAATAAAGAGGAAAGTAAAGGCATAGTCA
rJMSF019J12- AAACACAAATCCTAAAATCCATGGGAATATACAATAAAGAGGAAAGTAAAGGCATAGTCA
rJMSF017N16- AAACACAAATCCTAAAATCCATGGGAATATACAATAAAGAGGAAAGTAAAGGCATAGTCA
                      ____________________________________________________________
consensus AAACACAAATCCTAAAATCCATGGGAATATACAATAAAGAGGAAAGTAAAGGCATAGTCA
 
. : . : . : . : . : . :
rJMSF027A18- GGTATATATCAAACCACAAGCTTTGAACAACTGTAAGTAGAAAGTAGCATATGAAGTTAC
rJMSF019J12- GGTATATATCAAACCACAAGCTTTGAACAACTGTAAGTAGAAAGTAGCATATGAAGTTAC
rJMSF017N16- GGTATATATCAAACCACAAGCTTTGAACAACTGTAAGTAGAAAGTAGCATATGAAGTTAC
                      ____________________________________________________________
consensus GGTATATATCAAACCACAAGCTTTGAACAACTGTAAGTAGAAAGTAGCATATGAAGTTAC
 
. : . : . : . : . : . :
rJMSF027A18- CACAAATCCCCGTCAAACTAAGGTTTAATACTACTGGCCTGAAGAAGACCCTCCCGAATT
rJMSF019J12- CACAAATCCCCGTCAAACTAAGGTTTAATACTACTGGCCTGAAGAAGACCCTCCCGAATT
rJMSF017N16- CACAAATCCCCGTCAAACTAAGGTTTAATACTACTGGCCTGAAGAAGACCCTCCCGAATT
                      ____________________________________________________________
consensus CACAAATCCCCGTCAAACTAAGGTTTAATACTACTGGCCTGAAGAAGACCCTCCCGAATT
 
. : . : . : . : . : . :
rJMSF027A18- TGTGAGGAAATGTCTTTCACAGCACCTGGACCATGTGGGATAAACACAGAAGAGGACTTT
rJMSF019J12- TGTGAGGAAATGTCTTTCACAGCACCTGGACCATGTGGGATAAACACAGAAGAGGACTTT
rJMSF017N16- TGTGAGGAAATGTCTTTCACAGCACCTGGACCATGTGGGATAAACACAGAAGAGGACTTT
                      ____________________________________________________________
consensus TGTGAGGAAATGTCTTTCACAGCACCTGGACCATGTGGGATAAACACAGAAGAGGACTTT
 
. : . : . : . : . : . :
rJMSF027A18- GAAGATGAGCCAATCTCCTTCATTGTGTCGAAATATTGAGTCACCAGAACCATGTCCATG
rJMSF019J12- GAAGATGAGCCAATCTCCTTCATTGTGTCGAAATATTGAGTCACCAGAACCATGTCCATG
rJMSF017N16- GAAGATGAGCCAATCTCCTTCATTGTGTCGAAATATTGAGTCACCAGAACCATGTCCATG
                      ____________________________________________________________
consensus GAAGATGAGCCAATCTCCTTCATTGTGTCGAAATATTGAGTCACCAGAACCATGTCCATG
 
. : . : . : . : . : . :
rJMSF027A18- ATGTCTTTTGCTGTTGTCCCGGGAACATTCTATGAGAATGCAAGGACACTGTCTCTTAGC
rJMSF019J12- ATGTCTTTTGCTGTTGTCCCGGGAACATTCTCTGAGAATGCAAGGACACTGTCTCTTAGC
rJMSF017N16- ATGTCTTTTGCTGTTGTCCCGGGAACATTCTCTGAGAATGCAAGGACACTGTCTCTTAGC
                      ____________________________________________________________
consensus ATGTCTTTTGCTGTTGTCCCGGGAACATTCTCTGAGAATGCAAGGACACTGTCTCTTAGC
 
. : . : . : . : . : . :
rJMSF027A18- CCATCCACAATCGCTTGGCGCTGACGTGCAATGCCAAGTCCTGACAGGTATTTTGACTCT
rJMSF019J12- CCATCCACAATCGCTTGGCGCTGACGTGCAATGCCAAGTCCTGACAGGTATTTTGACTCT
rJMSF017N16- CCATCCACAATCGCTTGGCGCTGACGTGCAATGCCAAGTCCTGACAGGTATTTTGACTCT
                      ____________________________________________________________
consensus CCATCCACAATCGCTTGGCGCTGACGTGCAATGCCAAGTCCTGACAGGTATTTTGACTCT
 
. : . : . : . : . : . :
rJMSF027A18- GCTTCACCCTCAGCTTTCTTGATCTGCAGTATCTTCTCAGCTTCAGCCTTTTCATTTGCG
rJMSF019J12- GCTTCACCCTCAGCTTTCTTGATCTGCAGTATCTTCTCAGCTTCAGCCTTTTCATTTGCG
rJMSF017N16- GCTTCACCCTCAGCTTTCTTGATCTGCAGTATCTTCTCAGCTTCAGCCTTTTCATTTGCG
                      ____________________________________________________________
consensus GCTTCACCCTCAGCTTTCTTGATCTGCAGTATCTTCTCAGCTTCAGCCTTTTCATTTGCG
 
. : . : . : . : . : . :
rJMSF027A18- GCAACCCTAAGCCTTGCAGCAGCATTTATCTCATTCATTGCCCTCTTTACATGAATATCG
rJMSF019J12- GCAACCCTAAGCCTTGCAGCAGCATTTATCTCATTCATTGCCCTCTTTACATGAATATCG
rJMSF017N16- GCAACCCTAAGCCTTGCAGCAGCATTTATCTCATTCATTGCCCTCTTTACATGAATATCG
JMFN029J20+ GCCTTGCAGCAGCATTTATCTCATTCATTGCCCTCTTTACATGAATATCG
JMFS062C03+ CTCATTCATTGCCCTCTTTACATGAATATCG
JMSF027A18+ CAGCAGCATTTATCTCATTCATTGCCCTCTTTACATGAATATCG
                      ____________________________________________________________
consensus GCAACCCTAAGCCTTGCAGCAGCATTTATCTCATTCATTGCCCTCTTTACATGAATATCG
 
. : . : . : . : . : . :
rJMSF027A18- GGCTCTATATCCACAATGAGGGTCTGGACAATCTCAAATCCATAGGTAGACATAGCCTTC
rJMSF019J12- GGCTCTATATCCACAATGAGGGTCTGGACAATCTCAAATCCATAGGTAGACATAGCCTTC
rJMSF017N16- GGCTCTATATCCACAATGAGGGTCTGGACAATCTCAAATCCATAGGTAGACATAGCCTTC
JMSF019J12+ ACAATGAGGGTCTGGACAATCTCAAATCCATAGGTAGACATAGCCTTC
JMFN029J20+ GGCTCTATATCCACAATGAGGGTCTGGACAATCTCAAATCCATAGGTAGACATAGCCTTC
JMFS062C03+ GGCTCTATATCCACAATGAGGGTCTGGACAATCTCAAATCCATAGGTAGACATAGCCTTC
JMSF027A18+ GGCTCTATATCCACAATGAGGGTCTGGACAATCTCAAATCCATAGGTAGACATAGCCTTC
                      ____________________________________________________________
consensus GGCTCTATATCCACAATGAGGGTCTGGACAATCTCAAATCCATAGGTAGACATAGCCTTC
 
. : . : . : . : . : . :
rJMSF027A18- TCTAGCTCATCCTCCACTGCTTTAGCTATTTCATTCTTCTGCTC-AATGCAGCATC
rJMSF019J12- TCTAGCTCATCCTCCACTGCTTTAGCTATTTCATTCTTCTGCTCAAATGCAGCATCCAAA
rJMSF017N16- TCTAGCTCATCCTCCACTGCTTTAGCTATTTCATTCTTCTGCTCAAATGCAGCATCCAAA
JMSF019J12+ TCTAGCTCATCCTCCACTGCTTTAGCTATTTCATTCTTCTGCTCAAATGCAGCATCCAAA
JMFN029J20+ TCTAGCTCATCCTCCACTGCTTTAGCTATTTCATTCTTCTGCTCAAATGCAGCATCCAAA
JMFS062C03+ TCTAGCTCATCCTCCACTGCTTTAGCTATTTCATTCTTCTGCTCAAATGCAGCATCCAAA
JMSF027A18+ TCTAGCTCATCCTCCACTGCTTTAGCTATTTCATTCTTCTGCTCAAATGCAGCATCCAAA
JMSF017N16+ TTCTGCTCAAATGCAGCATCCAAA
                      ____________________________________________________________
consensus TCTAGCTCATCCTCCACTGCTTTAGCTATTTCATTCTTCTGCTCAAATGCAGCATCCAAA
 
. : . : . : . : . : . :
rJMSF019J12- TTCAATCTAGGCACACTGGCCCGTATGACATCAAATACATATGATTGGATCTGTGACTTT
rJMSF017N16- TTCAATCTAGGCACACTGGCCCGTATGACATCAAATACATATGATTGGATCTGTGACTTT
JMSF019J12+ TTCAATCTAGGCACACTGGCCCGTATGACATCAAATACATATGATTGGATCTGTGACTTT
JMFN029J20+ TTCAATCTAGGCACACTGGCCCGTATGACATCAAATACATATGATTGGATCTGTGACTTT
JMFS062C03+ TTCAATCTAGGCACACTGGCCCGTATGACATCAAATACATATGATTGGATCTGTGACTTT
JMSF027A18+ TTCAATCTAGGCACACTGGCCCGTATGACATCAAATACATATGATTGGATCTGTGACTTT
JMSF017N16+ TTCAATCTAGGCACACTGGCCCGTATGACATCAAATACATATGATTGGATCTGTGACTTT
                      ____________________________________________________________
consensus TTCAATCTAGGCACACTGGCCCGTATGACATCAAATACATATGATTGGATCTGTGACTTT
 
. : . : . : . : . : . :
rJMSF019J12- GTGTTCGAAAGCTGGTAAAATGCATCAGAAG
rJMSF017N16- GTGTTCGAAAGCTGGTAAAATGCATCANAAGCCTTTTCTGCC-AGGCTCGGTACTGAATG
JMSF019J12+ GTGTTCGAAAGCTTGTAAAATGCATCAGAAGCCTTTTCTGCCAAGGCTCGGTACTGAATG
JMFN029J20+ GTGTTCGAAAGCTTGTAAAATGCATCAGAAGCCTTTTCTGCCAAGGCTCGGTACTGAATG
JMFS062C03+ GTGTTCGAAAGCTTGTAAAATGCATCAGAAGCCTTTTCTGCCAAGGCTCGGTACTGAATG
JMSF027A18+ GTGTTCGAAAGCTTGTAAAATGCATCAGAAGCCTTTTCTGCCAAGGCTCGGTACTGAATG
JMSF017N16+ GTGTTCGAAAGCTTGTAAAATGCATCAGAAGCCTTTTCTGCCAAGGCTCGGTACTGAATG
                      ____________________________________________________________
consensus GTGTTCGAAAGCTTGTAAAATGCATCAGAAGCCTTTTCTGCCAAGGCTCGGTACTGAATG
 
. : . : . : . : . : . :
JMSF019J12+ GATGCAACCACAGTCACAAAGACATTGTCCTTTGTTTTTGTTTCACAACGAACATCAATC
JMFN029J20+ GATGCAACCACAGTCACAAAGACATTGTCCTTTGTTTTTGTTTCACAACGAACATCAATC
JMFS062C03+ GATGCAACCACAGTCACAAAGACATTGTCCTTTGTTTTTGTTTCACAACGAACATCAATC
JMSF027A18+ GATGCAACCACAGTCACAAAGACATTGTCCTTTGTTTTTGTTTCACAACGAACATCAATC
JMSF017N16+ GATGCAACCACAGTCACAAAGACATTGTCCTTTGTTTTTGTTTCACAACGAACATCAATC
                      ____________________________________________________________
consensus GATGCAACCACAGTCACAAAGACATTGTCCTTTGTTTTTGTTTCACAACGAACATCAATC
 
. : . : . : . : . : . :
JMSF019J12+ TGTTGCACACGCAGAGAAAGAGTACCAGCAGATTGATATCCCAAACACCAAGGAACACAA
JMFN029J20+ TGTTGCACACGCAGAGAAAGAGTACCAGCAGATTGATATCCCAAACACCAAGGAACACAA
JMFS062C03+ TGTTGCACACGCAGAGAAAGAGTACCAGCAGATTGATATCCCAAACACCAAGGAACACAA
JMSF027A18+ TGTTGCACACGCAGAGAAAGAGTA-CAGCAGATTGATATCCCAAACACCAAGGAACACAA
JMSF017N16+ TGTTGCACACGCAGAGAAAGAGTACCAGCAGATTGATATCCCAAACACCAAGGAACACAA
                      ____________________________________________________________
consensus TGTTGCACACGCAGAGAAAGAGTACCAGCAGATTGATATCCCAAACACCAAGGAACACAA
 
. : . : . : . : . : . :
JMSF019J12+ TGACACCCAGGCTCCAACACATCATCAAATTTGCCAAAGTGCTCCATCACAGCCACAGTG
JMFN029J20+ TGACACCCAGGCTCCAACACATCATCAAATTTGCCAAAGTGCTCCATCACAGCCACAGTG
JMFS062C03+ TGACACCCAGGCTCCAACACATCATCAAATTTGCCAAAGTGCTCCATCACAGCCACAGTG
JMSF027A18+ TGACACCCAGGCTCCAACACATCATCAAATTTGCCAAAGTGCTCCATCACAGCCACAGTG
JMSF017N16+ TGACACCCAGGCTCCAACACATCATCAAATTTGCCAAAGTGCTCCATCACAGCCACAGTG
                      ____________________________________________________________
consensus TGACACCCAGGCTCCAACACATCATCAAATTTGCCAAAGTGCTCCATCACAGCCACAGTG
 
. : . : . : . : . : . :
JMSF019J12+ GACTAATCTACTTGAAGACATCCAAGTGATTGACCCATTGTTCAAACCTTCGAAGAAAAG
JMFN029J20+ GACTGATCTACTTGAAGACATCCAAGTGATTGACCCATTGTTCAAACCTTCGAAGAAAAG
JMFS062C03+ GACTGATCTACTTGAAGACATCCAAGTGATTGACCCATTGTTCAAACCTTCGAAGAAAAG
JMSF027A18+ GACTGATCTACTTGAAGACATCCAAGTGATTGACCCATTGTTCAAACCTTCGAAGAAAAG
JMSF017N16+ GACTGATCTACTTGAAGACATCCAAGTGATTGACCCATTGTTCAAACCTTCGAAGAAAAG
                      ____________________________________________________________
consensus GACTGATCTACTTGAAGACATCCAAGTGATTGACCCATTGTTCAAACCTTCGAAGAAAAG
 
. : . : . : . : . : . :
JMSF019J12+ ACAGCAACGAGGGAGTTAGAAATTTCCGGCAACTTTCCTGGCGGTAAAGT
JMFN029J20+ ACAGCAACGAGGGAGTTAGAAATTTCCGGCAACTTTCCTGGCGGTAAAGTAGGGTACAAT
JMFS062C03+ ACAGCAACGAGGGAGTTAGAAATTTCCGGCAACTTTCCTGGCGGTAAAGTAGGGTACAAT
JMSF027A18+ ACAGCAACGAGGGAGTTAGAAATTTCCGGCAACTTTCCTGGCGGTAAAGTAGGGTACAAT
JMSF017N16+ ACAGCAACGAGGGAGTTAGAAATTTCCGGCAACTTTCCTGGCGGTAAAGTAGGGTACAAT
                      ____________________________________________________________
consensus ACAGCAACGAGGGAGTTAGAAATTTCCGGCAACTTTCCTGGCGGTAAAGTAGGGTACAAT
 
. : . : . : . : . : . :
JMFN029J20+ TAGAATTTA
JMFS062C03+ TAGAATTTACAGAGTATTTATACGCGGGTAGGAATTAGAATACCA
JMSF027A18+ TAGAATTTACAGAGTATTTATACGCGGGTAGGAATTAGAATACCA
JMSF017N16+ TAGAATTTACAGAGTATTTATACGTGGGTAGGAATTAGAATACCATACCACGAGCTGTTC
                      ____________________________________________________________
consensus TAGAATTTACAGAGTATTTATACGCGGGTAGGAATTAGAATACCATACCACGAGCTGTTC