Previous Contig 005717:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014M10Sequence488005717 (14)sp|O04066|ACBP_RICCO3e-31Acyl-CoA-binding protein (ACBP).>pir|T09844|T09844 acyl-CoA-binding protein - ca452005717 (14)sp|O04066|ACBP_RICCO2e-31Acyl-CoA-binding protein (ACBP).>pir|T09844|T09844 acyl-CoA-binding protein - ca
JMFF019B11Sequence488005717 (14)gb:AB071376_15227925e-31Panax ginseng ACBP mRNA for Acyl-CoA-binding protein, complete cds.450005717 (14)gb:AB071376_15227924e-31Panax ginseng ACBP mRNA for Acyl-CoA-binding protein, complete cds.
JMFF023M22Sequence471005717 (14)sp|O04066|ACBP_RICCO1e-37Acyl-CoA-binding protein (ACBP).>pir|T09844|T09844 acyl-CoA-binding protein - ca436005717 (14)sp|O04066|ACBP_RICCO1e-37Acyl-CoA-binding protein (ACBP).>pir|T09844|T09844 acyl-CoA-binding protein - ca
JMFF029N05Sequence488005717 (14)sp|O04066|ACBP_RICCO3e-31Acyl-CoA-binding protein (ACBP).>pir|T09844|T09844 acyl-CoA-binding protein - ca450005717 (14)sp|O04066|ACBP_RICCO2e-31Acyl-CoA-binding protein (ACBP).>pir|T09844|T09844 acyl-CoA-binding protein - ca
JMFN036F14Sequence451005717 (14)sp|O04066|ACBP_RICCO1e-25Acyl-CoA-binding protein (ACBP).>pir|T09844|T09844 acyl-CoA-binding protein - ca
JMSF006H21Sequence336005717 (14)sp|O04066|ACBP_RICCO3e-31Acyl-CoA-binding protein (ACBP).>pir|T09844|T09844 acyl-CoA-binding protein - ca409005717 (14)sp|O04066|ACBP_RICCO9e-31Acyl-CoA-binding protein (ACBP).>pir|T09844|T09844 acyl-CoA-binding protein - ca
JMSF006H23Sequence290006755 (3)gb:AP004339_18404512e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P051369005717 (14)sp|O04066|ACBP_RICCO8e-26Acyl-CoA-binding protein (ACBP).>pir|T09844|T09844 acyl-CoA-binding protein - ca
JMSF007H21Sequence425005717 (14)sp|O04066|ACBP_RICCO2e-31Acyl-CoA-binding protein (ACBP).>pir|T09844|T09844 acyl-CoA-binding protein - ca
JMSF017N10Sequence522005717 (14)sp|O04066|ACBP_RICCO4e-31Acyl-CoA-binding protein (ACBP).>pir|T09844|T09844 acyl-CoA-binding protein - ca799009558 (8)gb:CAR299062_16452353e-59Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can183.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF006H21- GGCAGGTTTCCCTCATCTTCAGTGTGGTTAATCAAGCAAAGCAG
rJMFF019B11+ ATCTTCAGTGTGGTTAATCAAGCAAAGCAG
JMFF019B11- ATCTTCAGTGTGGTTAATCAAGCAAAGCAG
JMFF029N05- TCAGTGTGGTTAATCAAGCAAAGCAG
rJMFF023M22+ CAGTGTGGTTAATCAAGCAAAGCAG
JMFF023M22- CAGTGTGGTTAATCAAGCAAAGCAG
rJMFF014M10+ ATCTTCAGTGTGGTTAATCAAGCAAAGCAG
rJMFF029N05+ TCAGTGTGGTTAATCAAGCAAAGCAG
JMFN036F14- CAG
rJMSF006H21+ TTCAGTGTGGTTAATCAAGCAAAGCAG
rJMSF006H23+ TCAAGCAAAGCAG
JMFF014M10- ATCTTCAGTGTGGTTAATCAAGCAAAGCAG
rJMSF007H21+ GGCAGGTTTCCCTCATCTTCAGTGTGGTTAATCAAGCAAAGCAG
JMSF017N10- GGCAGGTTTCCCTCATCTTCAGTGTGGTTAATCAAGCAAAGCAG
                      ____________________________________________________________
consensus GGCAGGTTTCCCTCATCTTCAGTGTGGTTAATCAAGCAAAGCAG
 
. : . : . : . : . : . :
JMSF006H21- ATCAAAGCTCTCTTGAAATTTCCAACGATGGGTTTGAAGGAGGAATTTGAAGAGTACGCT
rJMFF019B11+ ATCAAAGCTCTCTTGAAATTTCCAACGATGGGTTTGAAGGAGGAATTTGAAGAGTACGCT
JMFF019B11- ATCAAAGCTCTCTTGAAATTTCCAACGATGGGTTTGAAGGAGGAATTTGAAGAGTACGCT
JMFF029N05- ATCAAAGCTCTCTTGAAATTTCCAACGATGGGTTTGAAGGAGGAATTTGAAGAGTACGCT
rJMFF023M22+ ATCAAAGCTCTCTTGAAATTTCCAACGATGGGTTTGAAGGGGGAATTTGAAGAGTACGCT
JMFF023M22- ATCAAAGCTCTCTTGAAATTTCCAACGATGGGTTTGAAGGGGGAATTTGAAGAGTACGCT
rJMFF014M10+ ATCAAAGCTCTCTTGAAATTTCCAACGATGGGTTTGAAGGAGGAATTTGAAGAGTACGCT
rJMFF029N05+ ATCAAAGCTCTCTTGAAATTTCCAACGATGGGTTTGAAGGAGGAATTTGAAGAGTACGCT
JMFN036F14- ATCAAAGCTCTCTTGAAATTTCCAACGATGGGTTTGAAGGAGGAATTTGAAGAGTACGCT
rJMSF006H21+ ATCANAGCTCTCTTGAAATTTCCAACGATGGGTTTGAAGGAGGAATTTGAAGAGTACGCT
rJMSF006H23+ ATCAAAGCTCTCNTGAAATTTCCAACGATGGGTNTGAAGGAGGAATCTGAAGAGTACGCT
JMFF014M10- ATCAAAGCTCTCTTGAAATTTCCAACGATGGGTTTGAAGGAGGAATTTGAAGAGTACGCT
rJMSF007H21+ ATCAAAGCTCTCTTGAAATTTCCAACGATGGGTTTGAAGGAGGAATTTGAAGAGTACGCT
JMSF017N10- ATCAAAGCTCTCTTGAAATTTCCAACGATGGGTTTGAAGGAGGAATTTGAAGAGTACGCT
                      ____________________________________________________________
consensus ATCAAAGCTCTCTTGAAATTTCCAACGATGGGTTTGAAGGAGGAATTTGAAGAGTACGCT
 
. : . : . : . : . : . :
JMSF006H21- GAGAAAGCTAAGAAATTGCCTGAGAATACTACCAATGAAAACAAGCTCATTCT-CTATGG
rJMFF019B11+ GAGAAAGCTAAGAAATTGCCTGAGAATACTACCAATGAAAACAAGCTCATTCT-CTATGG
JMFF019B11- GAGAAAGCTAAGAAATTGCCTGAGAATACTACCAATGAAAACAAGCTCATTCT-CTATGG
JMFF029N05- GAGAAAGCTAAGAAATTGCCTGAGAATACTACCAATGAAAACAAGCTCATTCT-CTATGG
rJMFF023M22+ GAGAAAGCTAAGAAATTGCCTGAGAATACTACCAATGAAAACAAGCTCATTCT-CTATGG
JMFF023M22- GAGAAAGCTAAGAAATTGCCTGAGAATACTACCAATGAAAACAAGCTCATTCT-CTATGG
rJMFF014M10+ GAGAAAGCTAAGAAATTGCCTGAGAATACTACCAATGAAAACAAGCTCATTCT-CTATGG
rJMFF029N05+ GAGAAAGCTAAGAAATTGCCTGAGAATACTACCAATGAAAACAAGCTCATTCT-CTATGG
JMFN036F14- GAGAAAGCTAAGAAATTGCCTGAGAATACTACCAATGAAAACAAGCTCATTCTGCGGTGG
rJMSF006H21+ GAGAAAGCTAAGAAATTGCCTGAGAATACTACCAATGAAAACAAGCTCATTCT-CTATGG
rJMSF006H23+ GAGAAAGCTAAGAAATTGCCTGAGAATACTACCAATGAAAACAAGCTCATTCT-CTATGG
JMFF014M10- GAGAAAGCTAAGAAATTGCCTGAGAATACTACCAATGAAAACAAGCTCATTCT-CTATGG
rJMSF007H21+ GAGAAAGCTAAGAAATTGCCTGAGAATACTACCAATGAAAACAAGCTCATTCT-CTATGG
JMSF017N10- GAGAAAGCTAAGAAATTGCCTGAGAATACTACCAATGAAAACAAGCTCATTCT-CTATGG
                      ____________________________________________________________
consensus GAGAAAGCTAAGAAATTGCCTGAGAATACTACCAATGAAAACAAGCTCATTCT-CTATGG
 
. : . : . : . : . : . :
JMSF006H21- ACTTTACAAACAAGCCACAGTTGGGGATGTGAACACAAGCCGTCCGGGTATGTTCAACAT
rJMFF019B11+ ACTTTACAAACAAGCCACAGTTGGGGATGTGAACACAAGCCGTCCGGGTATTTTCAACAT
JMFF019B11- ACTTTACAAACAAGCCACAGTTGGGGATGTGAACACAAGCCGTCCGGGTATTTTCAACAT
JMFF029N05- ACTTTACAAACAAGCCACAGTTGGGGATGTGAACACAAGCCGTCCGGGTATGTTCAACAT
rJMFF023M22+ ACTTTACAAACAAGCCACAGTTGGGGATGTGAACACAAGCCGTCCGGGTATGTTCAACAT
JMFF023M22- ACTTTACAAACAAGCCACAGTTGGGGATGTGAACACAAGCCGTCCGGGTATGTTCAACAT
rJMFF014M10+ ACTTTACAAACAAGCCACAGTTGGGGATGTGAACACAAGCCGTCCGGGTATGTTCAACAT
rJMFF029N05+ ACTTTACAAACAAGCCACAGTTGGGGATGTGAACACAAGCCGTCCGGGTATGTTCAACAT
JMFN036F14- ACTTTACAAACAAGCCACAGTTGGGGATGTGAACACAAGCCGTCCGGGTATGTTCAACAT
rJMSF006H21+ ACTTTACAAACAAGCCACAGTTGGGGATGTGAACACAAGCCGTCCGGGTATGTTCAACAT
rJMSF006H23+ ACTTTACAAACAAGCCACAGTTGGGGATGTGAACACNAGCCGTCCGGGTATGTTCAACAT
JMFF014M10- ACTTTACAAACAAGCCACAGTTGGGGATGTGAACACAAGCCGTCCGGGTATGTTCAACAT
rJMSF007H21+ ACTTTACAAACAAGCCACAGTTGGGGATGTGAACACAAGCCGTCCGGGTATGTTCAACAT
JMSF017N10- ACTTTACAAACAAGCCACAGTTGGGGATGTGAACACAAGCCGTCCGGGTATGTTCAACAT
                      ____________________________________________________________
consensus ACTTTACAAACAAGCCACAGTTGGGGATGTGAACACAAGCCGTCCGGGTATGTTCAACAT
 
. : . : . : . : . : . :
JMSF006H21- GAAGGACAGAGCAAAGTGGGATGCTTGGAAGGCTATTGAAGGAAAATCCAAGGATGAAGC
rJMFF019B11+ GAAGGACAGAGCAAAGTGGGATGCTTGGAAGGCTATTGAAGGAAAATCCAAGGATGAAGC
JMFF019B11- GAAGGACAGAGCAAAGTGGGATGCTTGGAAGGCTATTGAAGGAAAATCCAAGGATGAAGC
JMFF029N05- GAAGGACAGAGCAAAGTGGGATGCTTGGAAGGCTATTGAAGGAAAATCCAAGGATGAAGC
rJMFF023M22+ GAAGGACAGAGCAAAGTGGGATGCTTGGAAGGCTATTGAAGGAAAATCCAAGGATGAAGC
JMFF023M22- GAAGGACAGAGCAAAGTGGGATGCTTGGAAGGCTATTGAAGGAAAATCCAAGGATGAAGC
rJMFF014M10+ GAAGGACAGAGCAAAGTGGGATGCTTGGAAGGCTATTGAAGGAAAATCCAAGGATGAAGC
rJMFF029N05+ GAAGGACAGAGCAAAGTGGGATGCTTGGAAGGCTATTGAAGGAAAATCCAAGGATGAAGC
JMFN036F14- GAAGGACAGAGCAAAGTGGGATGCTTGGAAGGCTATTGAAGGAAAATCCAAGGATGAAGC
rJMSF006H21+ GAAGGACAGAGCAAAGTGGGATGCTTGGAAGGCTATTGAAGGAAAATCCAAGGATGAAGC
rJMSF006H23+ GAAGGACAGAGCAAAGTGGGATGCTTGGAAGGCTATTGAAGGAAAATCCAAGGATGAAGC
JMFF014M10- GAAGGACAGAGCAAAGTGGGATGCTTGGAAGGCTATTGAAGGAAAATCCAAGGATGAAGC
rJMSF007H21+ GAAGGACAGAGCAAAGTGGGATGCTTGGAAGGCTATTGAAGGAAAATCCAAGGATGAAGC
JMSF017N10- GAAGGACAGAGCAAAGTGGGATGCTTGGAAGGCTATTGAAGGAAAATCCAAGGATGAAGC
                      ____________________________________________________________
consensus GAAGGACAGAGCAAAGTGGGATGCTTGGAAGGCTATTGAAGGAAAATCCAAGGATGAAGC
 
. : . : . : . : . : . :
JMSF006H21- TATGAGTGA-TTATATTACCAAGGTGAAACAGCTGCAGGAAGCAGCAGCTTCTT
rJMFF019B11+ TATGAGTGA-TTATATTACCAAGGTGAAACAGCTGCAGGAAGCAGCAGCTTCTTCTTGAT
JMFF019B11- TATGAGTGA-TTATATTACCAAGGTGAAACAGCTGCAGGAAGCAGCAGCTTCTTCTTGAT
JMFF029N05- TATGAGTGA-TTATATTACCAAGGTGAAACAGCTGCAGGAAGCAGCAGCTTCTTCTTGAT
rJMFF023M22+ TATGAGTGA-TTATATTACCAAGGTGAAACAGCTGCAGGAAGCAGCAGCTTCTTCTTGAT
JMFF023M22- TATGAGTGA-TTATATTACCAAGGTGAAACAGCTGCAGGAAGCAGCAGCTTCTTCTTGAT
rJMFF014M10+ TATGAGTGA-TTATATTACCAAGGTGAAACAGCTGCAGGAAGCAGCAGCTTCTTCTTGAT
rJMFF029N05+ TATGAGTGA-TTATATTACCAAGGTGAAACAGCTGCAGGAAGCAGCAGCTTCTTCTTGAT
JMFN036F14- TATGAGTGA-TTATATTACCAAGGTGAAACAGCTGCAGGAAGCAGCAGCTTCTTCTTGAT
rJMSF006H21+ TATGAGTGA-TTATATTNCCAAGGTGAAACAGCTGCAGGAAGCAGCAGCTTCTTCTNGAT
rJMSF006H23+ TATGAGTGATTTATATTACCAAGGTGAAACAGCTGCAGGAAGCAGCAGCTTCTTCTNGAT
JMFF014M10- TATGAGTGA-TTATATTACCAAGGTGAAACAGCTGCAGGAAGCAGCAGCTTCTTCTTGAT
rJMSF007H21+ TATGAGTGA-TTATATTACCAAGGTGAAACAGCTGCAGGAAGCAGCAGCTTCTTCTTGAT
JMSF017N10- TATGAGTGA-TTATATTACCAAGGTGAAACAGCTGCAGGAAGCAGCAGCTTCTTCTTGAT
                      ____________________________________________________________
consensus TATGAGTGA-TTATATTACCAAGGTGAAACAGCTGCAGGAAGCAGCAGCTTCTTCTTGAT
 
. : . : . : . : . : . :
rJMFF019B11+ GGCATGAATCACCTGCTCAATAAGTTAAATGTTATGGTCTGATCTATCCAGTCATGCTTG
JMFF019B11- GGCATGAATCACCTGCTCAATAAGTTAAATGTTATGGTCTGATCTATCCAGTCATGCTTG
JMFF029N05- GGCATGAATCACCTGCTCAATAAGTTAAATGTTATGGTCTGATCTATCCAGTCATGCTTG
rJMFF023M22+ GGCATGAATCACCTGCTCAATAAGTTAAATGTTATGGTCTGATCTATCCAGTCATGCTTG
JMFF023M22- GGCATGAATCACCTGCTCAATAAGTTAAATGTTATGGTCTGATCTATCCAGTCATGCTTG
rJMFF014M10+ GGCATGAATCACCTGCTCAATAAGTTAAATGTTATGGTCTGATCTATCCAGTCATGCTTG
rJMFF029N05+ GGCATGAATCACCTGCTCAATAAGTTAAATGTTATGGTCTGATCTATCCAGTCATGCTTG
JMFN036F14- GGCATGAATCACCTGCTCAATAAGTTAAATGTTATGGTCTGATCTATCCAGTCATGCTTG
rJMSF006H21+ GGCATGAATCACCTGCTCAATAAGTTAAATGTTATGGTCTGATCTATCCAGTCATGCTTG
rJMSF006H23+ GGCATGAATCACCTGCTCAATAAGTTAAANGTTATGGTCTGATCTATCCAGTCATGC
JMFF014M10- GGCATGAATCACCTGCTCAATAAGTTAAATGTTATGGTCTGATCTATCCAGTCATGCTTG
rJMSF007H21+ GGCATGAATCACCTGCTCAATAAGTTAAATGTTATGGTCTGATCTATCCAGTCATGCTTG
JMSF017N10- GGCATGAATCACCTGCTCAATAAGTTAAATGTTATGGTCTGATCTATCCAGTCATGCTTG
                      ____________________________________________________________
consensus GGCATGAATCACCTGCTCAATAAGTTAAATGTTATGGTCTGATCTATCCAGTCATGCTTG
 
. : . : . : . : . : . :
rJMFF019B11+ TTGCCTTATATTTAATGATCTCCCTATAGCCTGGAGAAAAACATATCTATGCATAAAACT
JMFF019B11- TTGCCTTATATTTAATGATCTCCCTATAGCCTGGAGAAAAACATATCTATGCATAAAACT
JMFF029N05- TTGCCTTATATTTAATGATCTCCCTATAGCCTGGAGAAAAACATATCTATGCATAAAACT
rJMFF023M22+ TTGCCTTATATTTAATGATCTCCCTATAGCCTGGAGAAAAACATATCTATGCA
JMFF023M22- TTGCCTTATATTTAATGATCTCCCTATAGCCTGGAGAAAAACATATCTATGCATAAAACT
rJMFF014M10+ TTGCCTTATATTTAATGATCTCCCTATAGCCTGGAGAAAAACATATCTATGCATAAAACT
rJMFF029N05+ TTGCCTTATATTTAATGATCTCCCTATAGCCTGGAGAAAAACATATCTATGCATAAAACT
JMFN036F14- TTGCCTTATATTTAATGATCTCCCTATAGCCTGGAGAAAAACATATCTATGCATAAAACT
rJMSF006H21+ TTGCCTTATATTTAATGATCT
JMFF014M10- TTGCCTTATATTTAATGATCTCCCTATAGCCTGGAGAAAAACATATCTATGCATAAAACT
rJMSF007H21+ TTGCCTTATATTTAATGATCTCC
JMSF017N10- TTGCCTTATATTTAATGATCTCCCTATAGCCTGGAGAAAAACATATCTATGCATAAAACT
                      ____________________________________________________________
consensus TTGCCTTATATTTAATGATCTCCCTATAGCCTGGAGAAAAACATATCTATGCATAAAACT
 
. : . : . : . : . : . :
rJMFF019B11+ GT
JMFF019B11- GTTGTGGTATTGATGGCTTATTTCTATGGTA
JMFF029N05- GTTGTGGTATTGATGGCTTATTTCTATGGTA
JMFF023M22- GTTGTGGTATTGATGGCT
rJMFF014M10+ GT
rJMFF029N05+ GT
JMFN036F14- GTTGTGGTATTGATGGCTTATTTCTATGG
JMFF014M10- GTTGTGGTATTGATGGCTTATTTCTATGGTA
JMSF017N10- GTTGTGGTATTGATGGCTTATTTCTATGGTATATTGCATGATTTTCTTATAAAAAAAAAA
                      ____________________________________________________________
consensus GTTGTGGTATTGATGGCTTATTTCTATGGTATATTGCATGATTTTCTTATAAAAAAAAAA