Previous Contig 005702:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009B02Sequence568005702 (20)gb:AY456411_16071862e-70Lycopersicon esculentum ribosomal protein L3 (RPL3) mRNA, complete cds.428005702 (20)gb:AY456411_16071865e-41Lycopersicon esculentum ribosomal protein L3 (RPL3) mRNA, complete cds.
JMFF034H05Sequence455005702 (20)gb:AY395739_16048282e-60Nicotiana tabacum ribosomal protein L3B (RPL3B) mRNA, complete cds.699005702 (20)gb:AY456411_1607186e-106Lycopersicon esculentum ribosomal protein L3 (RPL3) mRNA, complete cds.
JMFF035H23Sequence553005702 (20)gb:AY456411_16071862e-71Lycopersicon esculentum ribosomal protein L3 (RPL3) mRNA, complete cds.734005702 (20)gb:AY456411_1607186e-109Lycopersicon esculentum ribosomal protein L3 (RPL3) mRNA, complete cds.
JMFF048M16Sequence338005702 (20)gb:AY456411_16071862e-43Lycopersicon esculentum ribosomal protein L3 (RPL3) mRNA, complete cds.215005702 (20)gb:AB008848_15105603e-04Cucumis sativus Csf-3 mRNA, complete cds.
JMFN028F24Sequence621005702 (20)gb:AY456411_1607186e-103Lycopersicon esculentum ribosomal protein L3 (RPL3) mRNA, complete cds.
JMSF006B19Sequence353005702 (20)gb:AY456411_16071863e-46Lycopersicon esculentum ribosomal protein L3 (RPL3) mRNA, complete cds.332008750 (2)gb:AC134344_17417473e-33Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0059K16, complet
JMSF017K22Sequence222005702 (20)gb:AY395739_16048282e-19Nicotiana tabacum ribosomal protein L3B (RPL3B) mRNA, complete cds.787005702 (20)gb:AY456411_1607186e-121Lycopersicon esculentum ribosomal protein L3 (RPL3) mRNA, complete cds.
JMSF023K13Sequence673005702 (20)gb:AY395738_1604827e-112Nicotiana tabacum ribosomal protein L3A (RPL3A) mRNA, complete cds.790005702 (20)gb:AY456411_1607186e-115Lycopersicon esculentum ribosomal protein L3 (RPL3) mRNA, complete cds.
JMSF028N07Sequence673005702 (20)gb:AY395738_16048271e-95Nicotiana tabacum ribosomal protein L3A (RPL3A) mRNA, complete cds.803005702 (20)gb:AY456411_1607186e-126Lycopersicon esculentum ribosomal protein L3 (RPL3) mRNA, complete cds.
JMSF051I06Sequence687005702 (20)gb:AY395738_16048272e-95Nicotiana tabacum ribosomal protein L3A (RPL3A) mRNA, complete cds.749005702 (20)gb:AY456411_1607186e-115Lycopersicon esculentum ribosomal protein L3 (RPL3) mRNA, complete cds.
JMSF052C10Sequence687005702 (20)gb:AY395738_16048277e-97Nicotiana tabacum ribosomal protein L3A (RPL3A) mRNA, complete cds.954005702 (20)gb:AY395738_1604827e-140Nicotiana tabacum ribosomal protein L3A (RPL3A) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF048M16- ATTTTTTTTTAAATTAATATCTTGGGT
                      ____________________________________________________________
consensus ATTTTTTTTTAAATTAATATCTTGGGT
 
. : . : . : . : . : . :
rJMFF048M16- ATAGATTAAAACAACAAATCCTCCGTTTTAAGGTAATCGTTCAAAGGCAAGCAACAAAAC
rJMSF023K13- AATCCTCCGGTTTTAGGTAATCGTTCAAAGGCAAGCAACAAAAC
rJMSF028N07- AATCCTCCGGTTTTAGGTAATCGTTCAAAGGCAAGCAACAAAAC
rJMSF017K22- ACAAATCCTCCGTTTTAAGGTAATCGTTCAAAGGCAAGCAACAAAAC
rJMSF051I06- AATCCTCCGGTTTTAGGTAATCGTTCAAAGGCAAGCAACAAAAC
rJMFF034H05- CAAATCCTCCGTTTTAAGGTAATCGTTCAAAGGCAAGCAACAAAAC
rJMFF035H23- TAGATTAAAACAACAAATCCTCCGTTTTAAGGTAATCGTTCAAAGGCAAGCAACAAAAC
rJMFF009B02- TAGATTAAAACAACAAATCCTCCGTTTTAAGGTAATCGTTCAAAGGCAAGCAACAAAAC
rJMSF052C10- TAGATTAAAACAACAAATCCTCCGTTTTAAGGTAATCGTTCAAAGGCAAGCAACAAAAC
                      ____________________________________________________________
consensus ATAGATTAAAACAACAAATCCTCCGTTTTAAGGTAATCGTTCAAAGGCAAGCAACAAAAC
 
. : . : . : . : . : . :
rJMFF048M16- AAAATTTCAAGTCTCGAAAACGATGGATAATGATAAGGAATATAGTAATGCAGGCAAAGC
rJMSF023K13- AAAATTTCAAGTCTCGAAAACGATGGATAATGATAAGGAATATAGTAATGCAGGCAAAGC
rJMSF028N07- AAAATTTCAAGTCTCGAAAACGATGGATAATGATAAGGAATATAGTAATGCAGGCAAAGC
rJMSF017K22- AAAATTTCAAGTCTCGAAAACGATGGATAATGATAAGGAATATAGTAATGCAGGCAAAGC
rJMSF051I06- AAAATTTCAAGTCTCGAAAACGATGGATAATGATAAGGAATATAGTAATGCAGGCAAAGC
JMFN028F24+ CGAAAACGATGGATAATGATAAGGAATATAGTAATGCAGGCAAAGC
rJMFF034H05- AAAATTTCAAGTCTCGAAAACGATGGATAATGATAAGGAATATAGTAATGCAGGCAAAGC
rJMFF035H23- AAAATTTCAAGTCTCGAAAACGATGGATAATGATAAGGAATATAGTAATGCAGGCAAAGC
rJMFF009B02- AAAATTTCAAGTCTCGAAAACGATGGATAATGATAAGGAATATAGTAATGCAGGCAAAGC
rJMSF052C10- AAAATTTCAAGTCTCGAAAACGATGGATAATGATAAGGAATATAGTAATGCAGGCAAAGC
                      ____________________________________________________________
consensus AAAATTTCAAGTCTCGAAAACGATGGATAATGATAAGGAATATAGTAATGCAGGCAAAGC
 
. : . : . : . : . : . :
rJMFF048M16- ATACTTAGGCCTTGAGGCGGCCGAAGAACTTCTGCTTCTCCTGTGTGGTCTGGAAGCGAC
rJMSF023K13- ATACTTAGGCCTTGAGGCGGCCGAAGAACTTCTGCTTCTCCTGTGTGGTCTGGAAGCGAC
rJMSF028N07- ATACTTAGGCCTTGAGGCGGCCGAAGAACTTCTGCTTCTCCTGTGTGGTCTGGAAGCGAC
rJMSF017K22- ATACTTAGGCCTTGAGGCGGCCGAAGAACTTCTGCTTCTCCTGTGTGGTCTGGAAGCGAC
rJMSF051I06- ATACTTAGGCCTTGAGGCGGCCGAAGAACTTCTGCTTCTCCTGTGTGGTCTGGAAGCGAC
JMFN028F24+ ATACTTAGGCCTTGAGGCGGCCGAAGAACTTCTGCTTCTCCTGTGTGGTCTGGAAGCGAC
rJMFF034H05- ATACTTAGGCCTTGAGGCGGCCGAAGAACTTCTGCTTCTCCTGTGTGGTCTGGAAGCGAC
rJMFF035H23- ATACTTAGGCCTTGAGGCGGCCGAAGAACTTCTGCTTCTCCTGTGTGGTCTGGAAGCGAC
rJMFF009B02- ATACTTAGGCCTTGAGGCGGCCGAAGAACTTCTGCTTCTCCTGTGTGGTCTGGAAGCGAC
rJMSF052C10- ATACTTAGGCCTTGAGGCGGCCGAAGAACTTCTGCTTCTCCTGTGTGGTCTGGAAGCGAC
                      ____________________________________________________________
consensus ATACTTAGGCCTTGAGGCGGCCGAAGAACTTCTGCTTCTCCTGTGTGGTCTGGAAGCGAC
 
. : . : . : . : . : . :
rJMFF048M16- CGTGTCCA
rJMSF023K13- CGTGTCCAAACTTTGAGGAAGTGTCGATGAACTTGAGCTTAATCTCTTCAAGAGCAACAC
rJMSF028N07- CGTGTCCAAACTTTGAGGAAGTGTCGATGAACTTGAGCTTAATCTCTTCAAGAGCAACAC
rJMSF017K22- CGTGTCCAAACTTTGAGGAAGTGTCGATGAACTTGAGCTTAATCTCTTCAAGAGCAACAC
rJMSF051I06- CGTGTCCAAACTTTGAGGAAGTGTCGATGAACTTGAGCTTAATCTCTTCAAGAGCAACAC
JMFN028F24+ CGTGTCCAAACTTTGAGGAAGTGTCGATGAACTTGAGCTTAATCTCTTCAAGAGCAACAC
rJMFF034H05- CGTGTCCAAACTTTGAGGAAGTGTCGATGAACTTGAGCTTAATCTCTTCAAGAGCAACAC
rJMFF035H23- CGTGTCCAAACTTTGAGGAAGTGTCGATGAACTTGAGCTTAATCTCTTCAAGAGCAACAC
rJMFF009B02- CGTGTCCAAACTTTGAGGAAGTGTCGATGAACTTGAGCTTAATCTCTTCAAGAGCAACAC
rJMSF052C10- CGTGTCCAAACTTTGAGGAAGTGTCGATGAACTTGAGCTTAATCTCTTCAAGAGCAACAC
                      ____________________________________________________________
consensus CGTGTCCAAACTTTGAGGAAGTGTCGATGAACTTGAGCTTAATCTCTTCAAGAGCAACAC
 
. : . : . : . : . : . :
rJMSF023K13- GAGAGGTCTGGTTAAGCAAAG-ACTGGCGGAGGGTCACGACTCTTTTCTTGGGGCCAACA
rJMSF028N07- GAGAGGTCTGGTTAAGCAAAG-ACTGGCGGAGGGTCACGACTCTTTTCTTGGGGCCAACA
rJMSF017K22- GAGAGGTCTGGTTAAGCAAAG-ACTGGCGGAGGGTCACGACTCTTTTCTTGGGGCCAACA
rJMSF051I06- GAGAGGTCTGGTTAAGCAAAG-ACTGGCGGAGGGTCACGACTCTTTTCTTGGGGCCAACA
JMFN028F24+ GAGAGGTCTGGTTAAGCAAAG-ACTGGCGGAGGGTCACGACTCTTTTCTTGGGGCCAACA
rJMFF034H05- GAGAGGTCTGGTTAAGCAAAG-ACTGGCGGAGGGTCACGACTCTTTTCTTGGGGCCAACA
rJMFF035H23- GAGAGGTCTGGTTAAGCAAAG-ACTGGCGGAGGGTCACGACTCTTTTCTTGGGGCCAACA
rJMFF009B02- GAGAGGTCTGGTTAAGCAAAGAACTGGCGGAGGGTCACGACTCTTTTCTTGGGGCCAACA
rJMSF052C10- GAGAGGTCTGGTTAAGCAAAG-ACTGGCGGAGGGTCACGACTCTTTTCTTGGGGCCAACA
                      ____________________________________________________________
consensus GAGAGGTCTGGTTAAGCAAAG-ACTGGCGGAGGGTCACGACTCTTTTCTTGGGGCCAACA
 
. : . : . : . : . : . :
rJMSF023K13- CACCCGCCCTTGATCAAGAGGTAATCATCCTTCACCACACCATAGTGGGGGAATCCACCC
rJMSF028N07- CACCCGCCCTTGATCAAGAGGTAATCATCCTTCACCACACCATAGTGGGGGAATCCACCC
rJMSF017K22- CACCCGCCCTTGATCAAGAGGTAATCATCCTTCACCACACCATAGTGGGGGAATCCACCC
rJMSF051I06- CACCCGCCCTTGATCAAGAGGTAATCATCCTTCACCACACCATAGTGGGGGAATCCACCC
JMFN028F24+ CACCCGCCCTTGATCAAGAGGTAATCATCCTTCACCACACCATAGTGGGGGAATCCACCC
rJMFF034H05- CACCCGCCCTTGATCAAGAGGTAATCATCCTTCACCACACCATAGTGGGGGAATCCACCC
rJMFF035H23- CACCCGCCCTTGATCAAGAGGTAATCATCCTTCACCACACCATAGTGGGGGAATCCACCC
rJMFF009B02- CACCCGCCCTTGATCAAGAGGTAATCATCCTTCACCACACCATAGTGGGGGAATCCACCC
rJMSF052C10- CACCCGCCCTTGATCAAGAGGTAATCATCCTTCACCACACCATAGTGGGGGAATCCACCC
                      ____________________________________________________________
consensus CACCCGCCCTTGATCAAGAGGTAATCATCCTTCACCACACCATAGTGGGGGAATCCACCC
 
. : . : . : . : . : . :
rJMSF023K13- ATAGGAGTAATGTCCTTCTCGGTCCTGTCAAACTCAGTTAAAGCTGTATGATTTTCTTGT
rJMSF028N07- ATAGGAGTAATGTCCTTCTCGGTCCTGTCAAACTCAGTTAAAGCTGTATGATTTTCTTGT
rJMSF017K22- ATAGGAGTAATGTCCTTCTCGGTCCTGTCAAACTCAGTTAAAGCTGTATGATTTTCTTGT
rJMSF051I06- ATAGGAGTAATGTCCTTCTCGGTCCTGTCAAACTCAGTTAAAGCTGTATGATTTTCTTGT
JMFN028F24+ ATAGGAGTAATGTCCTTCTCGGTCCTGTCAAACTCAGTTAAAGCTGTATGATTTTCTTGT
rJMFF034H05- ATAGGAGTAATGTCCTTCTCGGTCCTGTCAAACTCAGTTAAAGCTGTATGATTTTCTTGT
rJMFF035H23- ATAGGAGTAATGTCCTTCTCGGTCCTGTCAAACTCAGTTAAAGCTGTATGATTTTCTTGT
rJMFF009B02- ATAGGAGTAATGTCCTTCTCGGTCCTGTCAAACTCAGTTAAAGCTGTATGATTTTCTT
rJMSF052C10- ATAGGAGTAATGTCCTTCTCGGTCCTGTCAAACTCAGTTAAAGCTGTATGATTTTCTTGT
                      ____________________________________________________________
consensus ATAGGAGTAATGTCCTTCTCGGTCCTGTCAAACTCAGTTAAAGCTGTATGATTTTCTTGT
 
. : . : . : . : . : . :
rJMSF023K13- CCTACTTTGCCAAGCTTATAGATCTTCTTGTTCAACTCAGTACGGTGGTGGTAACCATTC
rJMSF028N07- CCTACTTTGCCAAGCTTATAGATCTTCTTGTTCAACTCAGTACGGTGGTGGTAACCATTC
rJMSF017K22- CCTACTTTGCCAAGCTTATAGATCTTCTTGTTCAACTCAGTACGGTGGTGGTAACCATTC
rJMSF051I06- CCTACTTTGCCAAGCTTATAGATCTTCTTGTTCAACTCAGTACGGTGGTGGTAACCATTC
JMFN028F24+ CCTACTTTGCCAAGCTTATAGATCTTCTTGTTCAACTCAGTACGGTGGTGGTAACCATTC
rJMFF034H05- CCTACTTTGCCAAGCTTATAGATCTTCTTGTTCAACTCAGTACGGTGGTGGTAACCATTC
rJMFF035H23- CCTACTTTGCCAAGCTTATAGATCTTCTTGTTCAACTCAGTACGGTGGTGGTAACCATTC
rJMSF052C10- CCTACTTTGCCAAGCTTATAGATCTTCTTGTTCAACTCAGTACGGTGGTGGTAACCATTC
                      ____________________________________________________________
consensus CCTACTTTGCCAAGCTTATAGATCTTCTTGTTCAACTCAGTACGGTGGTGGTAACCATTC
 
. : . : . : . : . : . :
rJMSF023K13- TGACCAGCACGGGCAACTGTGAAGGAAACTCTAGCAGGATGCCAGGCACCAATACAAGCA
rJMSF028N07- TGACCAGCACGGGCAACTGTGAAGGAAACTCTAGCAGGATGCCAGGCACCAATACAAGCA
rJMSF017K22- TGACCAGCACGGGCAACTGTGAAGGAAACTCTAGCAGGATGCCAGGCACCAATACAAGCA
rJMSF051I06- TGACCAGCACGGGCAACTGTGAAGGAAACTCTAGCAGGATGCCAGGCACCAATACAAGCA
JMFN028F24+ TGACCAGCACGGGCAACTGTGAAGGAAACTCTAGCAGGATGCCAGGCACCAATACAAGCA
rJMFF034H05- TGACCAGCACGGGCAACTGTGAAGGAAACTCTAGCAGGATGCCAGGCACCAATACAAGCA
rJMFF035H23- TGACCAGCACGGGCAACTGTGAAGGAAACTCTAGCAGGATGCCAGGCACCAATACAAGCA
rJMSF052C10- TGACCAGCACGGGCAACTGTGAAGGAAACTCTAGCAGGATGCCAGGCACCAATACAAGCA
JMSF023K13+ TCTAGCAGGATGCCAGGCACCAATACAAGCA
                      ____________________________________________________________
consensus TGACCAGCACGGGCAACTGTGAAGGAAACTCTAGCAGGATGCCAGGCACCAATACAAGCA
 
. : . : . : . : . : . :
rJMSF023K13- ACCTTACGAAGCCCTCTGTGGGTTTTACGGGGAAGACGTGTGACACCCCAACGTGTCACA
rJMSF028N07- ACCTTACGAAGCCCTCTGTGGGTTTTACGGGGAAGACGTGTGACACCCCAACGTGTCACA
rJMSF017K22- ACCTTACGAAGCCCTCTGTGGGTTTTACGGGGAAGACGTGTGACACCCCAACGTGTCACA
rJMSF051I06- ACCTTACGAAGCCCTCTGTGGGTTTTACGGGGAAGACGTGTGACACCCCAACGTGTCACA
JMFN028F24+ ACCTTACGAAGCCCTCTGTGGGTTTTACGGGGAAGACGTGTGACACCCCAACGTGTCACA
rJMFF034H05- ACCTTACGAAGCCCTCTGTGGGTTTTACGGGGAAGACGTGTGACACCCCAACGTGTCACA
rJMFF035H23- ACCTTACGAAGCCCTCTGTGGGTTTTACGGGGAAGACGTGTGACACCCCAACGTGTCACA
rJMSF052C10- ACCTTACGAAGCCCTCTGTGGGTTTTACGGGGAAGACGTGTGACACCCCAACGTGTCACA
JMSF023K13+ ACCTTACGAAGCCCTCTGTGGGTTTTACGGGGAAGACGTGTGACACCCCAACGTGTCACA
                      ____________________________________________________________
consensus ACCTTACGAAGCCCTCTGTGGGTTTTACGGGGAAGACGTGTGACACCCCAACGTGTCACA
 
. : . : . : . : . : . :
rJMSF023K13- ACACCTTCATAACCCTTACCCTTAGTGACACCAATAATATCAATCATCTCATCCTTCTGG
rJMSF028N07- ACACCTTCATAACCCTTACCCTTAGTGACACCAATAATATCAATCATCTCATCCTTCTGG
rJMSF017K22- ACACCTTCATAACCCTTACCCTTAGTGACACCAATAATATCAATCATCTCATCCTTCTGG
rJMSF051I06- ACACCTTCATAACCCTTACCCTTAGTGACACCAATAATATCAATCATCTCATCCTTCTGG
JMFN028F24+ ACACCTTCATAACCCTTACCCTTAGTGACACCAATAATATCAATCATCTCATCCTTCTGG
rJMFF034H05- ACACCTTCATAACCCTTACCCTTAGTGACACCAATAATATCAATCATCTCATCCTTCTGG
rJMFF035H23- ACACCTTCATAACCCTTACCCTTAGTGACACCAATAATATCAATCATCTCATCCTTCTGG
rJMSF052C10- ACACCTTCATAACCCTTACCCTTAGTGACACCAATAATATCAATCATCTCATCCTTCTGG
JMSF023K13+ ACACCTTCATAACCCTTACCCTTAGTGACACCAATAATATCAATCATCTCATCCTTCTGG
                      ____________________________________________________________
consensus ACACCTTCATAACCCTTACCCTTAGTGACACCAATAATATCAATCATCTCATCCTTCTGG
 
. : . : . : . : . : . :
rJMSF023K13- AAAACAGCGTCAATTGGCACCTGCTTCTCAAAGAAACCATATGCAAAGTCAACTTTCTGT
rJMSF028N07- AAAACAGCGTCAATTGGCACCTGCTTCTCAAAGAAACCATATGCAAAGTCAACTTTCTGT
rJMSF017K22- AAAACAGCGTCAATTGGCACCTGCTTCTCAAAGAAACCATATGCAAAGTCAACTTTCTGT
rJMSF051I06- AAAACAGCGTCAATTGGCACCTGCTTCTCAAAGAAACCATATGCAAAGTCAACTTTCTGT
JMFN028F24+ AAAACAGCGTCAATTGGCACCTGCTTCTCAAAGAAA
rJMFF034H05- AAAACAGCGTCAATTGGCACCTGCTTCTCAAAGAAACCATATGCAAAGTCAACT
rJMFF035H23- AAAACAGCGTCAATTGGCACCTGCTTCTCAAAGAAACCATATGCAAAGTCAACTTTCTGT
rJMSF052C10- AAAACAGCGTCAATTGGCACCTGCTTCTCAAAGAAACCATATGCAAAGTCAACTTTCTGT
JMSF023K13+ AAAACAGCGTCAATTGGCACCTGCTTCTCAAAGAAACCATATGCAAAGTCAACTTTCTGT
JMSF028N07+ TTCTCAANGAAACCATATGCAAAGTCAACTTTCTGT
JMSF051I06+ TTCTCAANGAAACCATATGCAAAGTCAACTTTCTGT
JMSF052C10+ CTCAAAGAAACCATATGCAAAGTCAACTTTCTGT
                      ____________________________________________________________
consensus AAAACAGCGTCAATTGGCACCTGCTTCTCAAAGAAACCATATGCAAAGTCAACTTTCTGT
 
. : . : . : . : . : . :
rJMSF023K13- GCTATTGTCCCACCATTAACCTGGATTTCCATCACATGAGCCTTCTTCTGCTTTCAACCC
rJMSF028N07- GCTATTGTCCCACCATTAACCTGGATTTCCATCACATGAGCCTTCTTCTGC-TTCAACCC
rJMSF017K22- GCTATTGTCCCACCATTAACCTGGATTTCCATCACATGAGCCTNCTTCTGC-TNCAACCC
rJMSF051I06- GCTATTGTCCCACCATTAACCTGGATTTCCATCACATGAGCCT
rJMFF035H23- GCTATTGT
rJMSF052C10- GCTATTGTCCCACCATTAACCTGGATTTCCATCACATGAGCCTTCTTCTGC-TTCAACCC
JMSF023K13+ GCTATTGTCCCACCATTAACCTGGATTTCCATCACATGAGCCTTCTTCTGC-TTCAACCC
JMSF028N07+ GCTATTGTCCCACCATTAACCTGGATTTCCATCACATGAGCCTTCTTCTGC-TTCAACCC
JMSF051I06+ GCTATTGTCCCACCATTAACCTGGATTTCCATCACATGAGCCTTCTTCTGC-TTCAACCC
JMSF052C10+ GCTATTGTCCCACCATTAACCTGGATTTCCATCACATGAGCCTTCTTCTGC-TTCAACCC
                      ____________________________________________________________
consensus GCTATTGTCCCACCATTAACCTGGATTTCCATCACATGAGCCTTCTTCTGC-TTCAACCC
 
. : . : . : . : . : . :
rJMSF023K13- CNTTCATCTTCCTTATCTGGGTGTGAG
rJMSF028N07- C-TTCATCTTCCTTATCTGGGTGTGAGCCAGCACACGGATA
rJMSF017K22- C-TTCATCTTCCTTATCTGGGTG
rJMSF052C10- C-TTCATCTTCCTTATCTGGGTGTGAGCCAGCACACGGATAACACAGGAATATTTCTTCA
JMSF023K13+ C-TTCATCTTCCTTATCTGGGTGTGAGCCAGCACACGGATAACACAGGAATATTTCTTCA
JMSF028N07+ C-TTCATCTTCCTTATCTGGGTGTGAGCCAGCACACGGATAACACAGGAATATTTCTTCA
JMSF051I06+ C-TTCATCTTCCTNATCTGGGTGTGAGCCAGCACACGGATAACACAGGAATATTTCTTCA
JMFF035H23+ ACACAGGAATATTTCTTCA
JMFF009B02+ GTGTGAGCCAGCACACGGATAACACAGGAATATTTNTTCA
JMSF052C10+ C-TTCATCTTCCTTATCTGGGTGTGAGCCAGCACACGGATAACACAGGAATATTTCTTCA
                      ____________________________________________________________
consensus C-TTCATCTTCCTTATCTGGGTGTGAGCCAGCACACGGATAACACAGGAATATTTCTTCA
 
. : . : . : . : . : . :
rJMSF052C10- ACTTCTCTAGCTGAGACTGGATATCCTTCTTTCCTTCTTCAGATTCGTATTTCTTTTGAA
JMSF023K13+ ACTTCTCTAGCTGAGACTGGATATCCTTCTTTCCTTCTTCAGATTCGTATTTC-TTTGAA
JMSF028N07+ ACTTCTCTAGCTGAGACTGGATATCCTTCTTTCCTTCTTCAGATTCGTATTTC-TTTGAA
JMSF051I06+ ACTTCTCTAGCTGAGACTGGATATCCTTCTTTCCTTCTTCAGATTCGTATTTC-TTTGAA
JMFF035H23+ ACTTCTCTAGCTGAGACTGGATATCCTTCTTTCCTTCTTCAGATTCGTATTTC-TTTGAA
JMFF009B02+ ANTTCTNTAGNTGAGACTGGATATCNTTCTTTCCTTCTTCAGATTNGTATTTC-TTTGAA
JMSF052C10+ ACTTCTCTAGCTGAGACTGGATATCCTTCTTTCCTTCTTCAGATTCGTATTTC-TTTGAA
                      ____________________________________________________________
consensus ACTTCTCTAGCTGAGACTGGATATCCTTCTTTCCTTCTTCAGATTCGTATTTC-TTTGAA
 
. : . : . : . : . : . :
rJMSF052C10- TACTTGCTAAATGCCTTCTTCTTGGACTTGCACCAGTTCTTGTAAA
JMSF023K13+ TACTTGCTAAATGCCTTCTTCTTGGACTTGCACCAGTTCTTGTAAAACCTCCTTCTCAAC
JMSF028N07+ TACTTGCTAAATGCCTTCTTCTTGGACTTGCACCAGTTCTTGTAAAACCTCCTTCTCAAC
JMSF051I06+ TACTTGCTAAATGCCTTCTTCTTGGACTTGCACCAGTTCTTGTAAAACCTCCTTCTCAAC
JMFF035H23+ TACTTGCTAAATGCCTTCTTCTTGGACTTGCACCAGTTCTTGTAAAACCTCCTTCTCAAC
JMFF009B02+ TACTTGNTAAATGCNTTNTTNTTGGACTTGCACCAGTTNTTGTAAAACCTCCTTCTCAAC
JMFF034H05+ TTGGACTTGCACCAGTTCTTGTAAAACCTCCTTCTCAAC
JMSF052C10+ TACTTGCTAAATGCCTTCTTCTTGGACTTGCACCAGTTCTTGTAAAACCTCCTTCTCAAC
                      ____________________________________________________________
consensus TACTTGCTAAATGCCTTCTTCTTGGACTTGCACCAGTTCTTGTAAAACCTCCTTCTCAAC
 
. : . : . : . : . : . :
JMSF023K13+ TCCTCATTCAGATGTTGAGCCCAAACAGTGTTCAGGCATCGAAGACCACGTGGTGTTTTC
JMSF028N07+ TCCTCATTCAGATGTTGAGCCCAAACAGTGTTCAGGCATCGAAGACCACGTGGTGTTTTC
JMSF051I06+ TCCTCATTCAGATGTTGAGCCCAAACAGTGTTCAGGCATCGAAGACCACGTGGTGTTTTC
JMFF035H23+ TCCTCATTCAGATGTTGAGCCCAAACAGTGTTCAGGCATCGAAGACCACGTGGTGTTTTC
JMFF009B02+ TCCTCATTCAGATGTTGAGCCCAAACAGTGTTCAGGCATCGAAGACCACGTGGTGTTTTC
JMFF034H05+ TCCTCATTCAGATGTTGAGCCCAAACAGTGTTCAGGCATCGAAGACCACGTGGTGTTTTC
JMSF052C10+ TCCTCATTCAGATGTTGAGCCCAAACAGTGTTCAGGCATCGAAGACCACGTGGTGTTTTC
                      ____________________________________________________________
consensus TCCTCATTCAGATGTTGAGCCCAAACAGTGTTCAGGCATCGAAGACCACGTGGTGTTTTC
 
. : . : . : . : . : . :
JMSF023K13+ ACATAGCCAACAACT-CCAACAATTACCATCGGAGGTGTTTCAACAATGGTCACAGCCTC
JMSF028N07+ ACATAGCCAACAACT-CCAACAATTACCATCGGAGGTGTTTCAACAATGGTCACAGCCTC
JMSF051I06+ ACATAGCCAACAACT-CCAACAATTACCATCGGAGGTGTTTCAACAATGGTCACAGCCTC
JMSF006B19+ CATAGCCAACAACT-CCAACAATTACCATCGGAGGTGTTTCAACAATGGTCACAGCCTC
JMFF048M16+ CCAACAATTACCATGGGAGGTGTTTCAACAATGGTCACAGCCTC
JMFF035H23+ ACATAGCCAACAACT-CCAACAATTACCATCGGAGGTGTTTCAACAATGGTCACAGCCTC
JMFF009B02+ ACATAGCCAACAACTCCAACCAATTACCATCGGAGGTGTTTCAACAATGGTCACAGCCTC
JMFF034H05+ ACATAGCCAACAACTCCCNACTATTACCATCGGAGGTGTTTCAACAATGGTCACAGCCTC
JMSF052C10+ ACATAGCCAACAACT-CCAACAATTACCATCGGAGGTGTTTCAACAATGGTCACAGCCTC
                      ____________________________________________________________
consensus ACATAGCCAACAACT-CCAACAATTACCATCGGAGGTGTTTCAACAATGGTCACAGCCTC
 
. : . : . : . : . : . :
JMSF023K13+ ACAAGTCTCTTTCTTGTGAAGTTTCGATCCTGGTTTCTCAACTTCTCTGACAATGTGAGT
JMSF028N07+ ACAAGTCTCTTTCTTGTGAAGTTTCGATCCTGGTTTCTCAACTTCTCTGACAATGTGAGT
JMSF051I06+ ACAAGTCTCTTTCTTGTGAAGTTTCGATCCTGGTTTCTCAACTTCTCTGACAATGTGAGT
JMSF006B19+ ACAAGTCTCTTTCTTGTGAAGTTTCGATCCTGGTTTCTCAACTTCTCTGACAATGTGAGT
JMFF048M16+ ACAAGTCTCTTTCTTGTGAAGTTTCGATCCTGGTTTCTCAACTTCTCTGACAATGTGAGT
JMFF035H23+ ACAAGTCTCTTTCTTGTGAAGTTTCGATCCTGGTTTCTCAACTTCTCTGACAATGTGAGT
JMFF009B02+ ACAAGTCTCTTTCTTGTGAAGTTTCGATCCTGGTTTCTCAACTTCTCTGACAATGTGAGT
JMFF034H05+ ACAAGTCTCTTTCTTGTGAAGTTTCGATCCTGGTTTCTCAACTTCTCTGACAATGTGAGT
JMSF052C10+ ACAAGTCTCTTTCTTGTGAAGTTTCGATCCTGGTTTCTCAACTTCTCTGACAATGTGAGT
                      ____________________________________________________________
consensus ACAAGTCTCTTTCTTGTGAAGTTTCGATCCTGGTTTCTCAACTTCTCTGACAATGTGAGT
 
. : . : . : . : . : . :
JMSF023K13+ CATGCCAGCCTTGTAACCCAAGAATGCAGTCAGCCTGCAAGGCTTG
JMSF028N07+ CATGCCAGCCTTGTAACCCAAGAATGCAGTCAGCCTGCAAGGCTTGCTCGAGTCATCCTT
JMSF051I06+ CATGCCAGCCTTGTAACCCAAGAATGCAGTCAGCCTGCAAGGCTTGCTCGAGTCATCCTT
JMSF006B19+ CATGCCAGCCTTGTAACCCAAGAATGCAGTCAGCCTGCAAGGCTTGCTCGAGTCATCCTT
JMFF048M16+ CATGCCAGCCTTGTAACCCAAGAATGCAGTCAGCCTGCAAGGCTTGCTCGAGTCATCCTT
JMFF035H23+ CATGCCAGCCTTGTAACCCAAGAATGCAGTCAGCCTGCAAGGCTTGCTCGAGTCATCCTT
JMFF009B02+ CATGCCAGCCTTGTAACCCAAGAATGCAGTCAGCCTGCAAGGCTTGCTCGAGTCATCCTT
JMFF034H05+ CATGCCAGCCTTGTAACCCAAGAATGCAGTCAGCCTGCAAGGCTTGCTCGAGTCATCCTT
JMSF052C10+ CATGCCAGCCTTGTAACCCAAGAATGCAGTCAGCCTGCAAGGCTTGCTCGAGTCATCCTT
JMSF017K22+ CAAGAATGCAGTCAGCCTGCAAGGCTTGCTCGAGTCATCCTT
                      ____________________________________________________________
consensus CATGCCAGCCTTGTAACCCAAGAATGCAGTCAGCCTGCAAGGCTTGCTCGAGTCATCCTT
 
. : . : . : . : . : . :
JMSF028N07+ AGGAAATGCCTTCACCTTTCCCTTCTGTCGGGAAGCACGCTTCCTGGGAAGAAATCCAAG
JMSF051I06+ AGGAAATGCCTTCACCTTTCCCCTCTGTCGGGAAGCACGCTTCCTGGGAAGAAATCCAAG
JMSF006B19+ AGGAAATGCCTTCACCTTTCCCCTCTGTCGGGAAGCACGCCTCCTGGGAAGAAATCCAAG
JMFF048M16+ AGGAAATGCCTTCACCTTTCCCCTCTGTCGGGAAGCACGCTTCCTGGGAAGAAATCCAAG
JMFF035H23+ AGGAAATGCCTTCACCTTTCCCCTCTGTCGGGAAGCACGCTTCCTGGGAAGAAATCCAAG
JMFF009B02+ AGGAAATGCCTTCACCTTTCCCCTCTGTCGGGAAGCACGCTTCCTGGGAAGAAATCCAAG
JMFF034H05+ AGGAAATGCCTTCACCTTTCCCCTCTGTCGGGAAGCACGCTTCCTGGGAAGAAATCCAAG
JMSF052C10+ AGGAAATGCCTTCACCTTTCCCCTCTGTCGGGAAGCACGCTTCCTGGGAAGAAATCCAAG
JMSF017K22+ AGGAAATGCCTTCACCTTTCCCCTCTGTCGGGAAGCACGCTTCCTGGGAAGAAATCCAAG
                      ____________________________________________________________
consensus AGGAAATGCCTTCACCTTTCCCCTCTGTCGGGAAGCACGCTTCCTGGGAAGAAATCCAAG
 
. : . : . : . : . : . :
JMSF028N07+ AGACCCATGCCTTGGGTGCTCAAACTTCCTGTGAGACATCTCTCTCCTGCTGCTTCAAAC
JMSF051I06+ AGACCCATGCCTTGGGTGCTCAAACTTCCTGTGAGACATCTCTCTCCTGCTGCTTCAAAC
JMSF006B19+ AGACCCATGCCTTGGGTGCTCAAACTTCCTGTGAGACATCTCTCTCCTGCTGCTTCAAAC
JMFF048M16+ AGACCCATGCCTTGGGTGCTCAAACTTCCTGTGAGACATCTCTCTCCTGCTGCTTCAAAC
JMFF035H23+ AGACCCATGCCTTGGGTGCTCAAACTTCCTGTGAGACATCTCTCTCCTGCTGCTTCAAAC
JMFF009B02+ AGACCCATGCCTTGGGTGCTCAAACTTCCTGTGAGACATCTCTCTCCTGCTGCTTCAAAC
JMFF034H05+ AGACCCATGCCTTGGGTGCTCAAACTTCCTGTGAGACATCTCTCTCCTGCTGCTTCAAAC
JMSF052C10+ AGACCCATGCCTTGGGTGCTCAAACTTCCTGTGAGACATCTCTCTCCTGCTGCTTCAAAC
JMSF017K22+ AGACCCATGCCTTGGGTGCTCAAACTTCCTGTGAGACATCTCTCTCCTGCTGCTTCAAAC
                      ____________________________________________________________
consensus AGACCCATGCCTTGGGTGCTCAAACTTCCTGTGAGACATCTCTCTCCTGCTGCTTCAAAC
 
. : . : . : . : . : . :
JMSF028N07+ TCTGCAATCTTAGCGGTACGGCCACCTTCTGGGGAGCTCT
JMSF051I06+ TCTGCAATCTTAGCGGTACGGCCACCTTCTGGGGAGCTCTGAGCTTCAACCCTC
JMSF006B19+ TCTGCAATCTTAGCGGTACGGCCACCTTCTGGGGAGCTCTGAGCTTCAACCCTC
JMFF048M16+ TCTGCAATCTTAGCGGTACGGCCACCTTCTGGGGAGCTCTGAGCTTCAACCCTC
JMFF035H23+ TCTGCAATCTTAGCGGTACGGCCACCTTCTGGGGAGCTCTGAGCTTCAACCCTCGC
JMFF009B02+ -------TCTTAGCGGTACGGCCACCTTCTGGGGAGCTCTGAGCTTCAACCCTCGC
JMFF034H05+ TCTGCAATCTTAGCGGTACGGCCACCTTCTGGGGAGCTCTGAGCTTCAACCCTCGC
JMSF052C10+ TCTGCAATCTTAGCGGTACGGCCACCTTCTGGGGAGCTCTGAGCTTCAACCCTCGC
JMSF017K22+ TCTGCAATCTTAGCGGTACGGCCACCTTCTGGGGAGCTCTGAGCTTCAACCCTCGCAGAC
                      ____________________________________________________________
consensus TCTGCAATCTTAGCGGTACGGCCACCTTCTGGGGAGCTCTGAGCTTCAACCCTCGCAGAC