Previous Contig 005701:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021M15Sequence167005701 (5)557003333 (30)gb:AF190656_17754391e-55Nicotiana tabacum clone 1 poly(A)-binding protein (PABP1) mRNA, partial cds.
JMFF037L12Sequence131005701 (5)
JMSF017K12Sequence171005701 (5)690003333 (30)gb:AF190656_17754396e-56Nicotiana tabacum clone 1 poly(A)-binding protein (PABP1) mRNA, partial cds.
JMSF026G11Sequence171005701 (5)742003333 (30)gb:AF190656_17754393e-58Nicotiana tabacum clone 1 poly(A)-binding protein (PABP1) mRNA, partial cds.
JMSF029A05Sequence172005701 (5)699003333 (30)gb:AF190656_17754393e-56Nicotiana tabacum clone 1 poly(A)-binding protein (PABP1) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF021M15+ TTTTTTTTTTGGGTTTTTTTGATANGNTTTTTTAAACC-TTNAAAAAAAAAA
JMSF026G11+ TTTTTTGGGTTTTTTTGNTNTGNTTTTTTAAACC-NTNAAAAAAAAAA
JMFF037L12+ TAAAAAAAAAAA
JMSF029A05+ TTTTTTAAACCTTTAAAAAAAAAAA
JMSF017K12+ TTTTTTGGGTTTTTTTGNTNTGNTTTTTNAAACC-NTNAAAAAAAAAA
                      ____________________________________________________________
consensus TTTTTTTTTTGGGTTTTTTTGATATGNTTTTTTAAACC-TTAAAAAAAAAAA
 
. : . : . : . : . : . :
JMFF021M15+ AAATAAAGAGAGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGG
JMSF026G11+ AAATAAAGAGAGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGG
JMFF037L12+ AAATAAAGAGAGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGG
JMSF029A05+ AAATAAAGAGAGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGG
JMSF017K12+ AAATAAAGAGAGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGG
                      ____________________________________________________________
consensus AAATAAAGAGAGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGG
 
. : . : . : . : . : . :
JMFF021M15+ ACGAAGAGATCGCCGCCGGTGACTGAAATAGCAGACAGAGAGGAAGAGATGGAGAG
JMSF026G11+ ACGAAGAGATCGCCGCCGGTGACTGAAATAGCAGACAGAGAGGAAGAGATGGAGAGGGCC
JMFF037L12+ ACGAAGAGATCGCCGCCGGTGACTGAAATAGCAGACAGAGAGGAAGAGATGGAGAGGGC
JMSF029A05+ ACGAAGAGATCGCCGCCGGTGACTGAAATAGCAGACAGAGAGGAAGAGATGGAGAGGGCC
JMSF017K12+ ACGAAGAGATCGCCGCCGGTGACTGAAATAGCAGACAGAGAGGAAGAGATGGAGAGGGCC
                      ____________________________________________________________
consensus ACGAAGAGATCGCCGCCGGTGACTGAAATAGCAGACAGAGAGGAAGAGATGGAGAGGGCC