Previous Contig 005699:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF045N22Sequence635005699 (5)gb:OSJN00204_16966688e-39Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0039L24, complete seque612021743gb:AY080837_15685303e-57Arabidopsis thaliana putative RNA helicase (At4g00660) mRNA, complete cds.>gb:AY
JMFF050E01Sequence616005699 (5)gb:OSJN00204_16966681e-39Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0039L24, complete seque597010976 (2)gb:AY080837_15685301e-58Arabidopsis thaliana putative RNA helicase (At4g00660) mRNA, complete cds.>gb:AY
JMSF017K01Sequence417005699 (5)181012864 (3)
JMSF032M18Sequence663005699 (5)gb:OSJN00204_16966685e-49Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0039L24, complete seque192012864 (3)
JMSF050C14Sequence707005699 (5)gb:OSJN00204_16966683e-51Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0039L24, complete seque149012864 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032M18+ GCAGGAATG
JMSF050C14+ ACTTGAATAGAGTTGATGTCAATATCAATTTTTCTAAGGCAGGAATG
                      ____________________________________________________________
consensus ACTTGAATAGAGTTGATGTCAATATCAATTTTTCTAAGGCAGGAATG
 
. : . : . : . : . : . :
JMSF032M18+ CAGAAGGCAGCCGTTTTTCCAGTTCCATTCTTAGCTCTAGCAAGAATATCACTTCCAGTT
JMFF050E01+ AGCAAGAATATCACTTCCAGTT
JMFF045N22+ AGCAAGAATATCACTTCCAGTA
JMSF050C14+ CAGAAGGCAGCCGTTTTTCCAGTTCCATTCTTAGCTCTAGCAAGAATATCACTTCCAGTT
                      ____________________________________________________________
consensus CAGAAGGCAGCCGTTTTTCCAGTTCCATTCTTAGCTCTAGCAAGAATATCACTTCCAGTT
 
. : . : . : . : . : . :
JMSF032M18+ AGGGCAATTGGAATACTTTCCTCCTGTATTGGCGACGGTTTCTCAAACCCCTTCTCATAA
JMFF050E01+ AGGGCAATTGGAATACTTTCCTCCTGTATNGGCGACGGTTTCTCAAACCCCTTCTCATAA
JMFF045N22+ GGGGCAATGGANATACTTTCCTCCTGTATNGGCGACGGTTTCTCAAACCCCTTCTCATAA
JMSF050C14+ AGGGCAATTGGAATACTTTCCTCCTGTATTGGCGACGGTTTCTCAAACCCCTTCTCATAA
                      ____________________________________________________________
consensus AGGGCAATTGGAATACTTTCCTCCTGTATTGGCGACGGTTTCTCAAACCCCTTCTCATAA
 
. : . : . : . : . : . :
JMSF032M18+ ATCCCCATGAGCAGTTCACGTTTCAAAAAGTAGTCTTCAAATTCATTCCCCTTAGTTGCT
JMFF050E01+ ATCCCCATGAGCAGTTCACGTTTCAAAAAGTAGTCTTCAAATTCATTCCCCTTAGTTGCT
JMFF045N22+ ATCCCCATGAGCAGTTCACGTTTCAAAAAGTAGTCTTCAAATTCATTCCCCTTAGTTGCT
JMSF050C14+ ATCCCCATGAGCAGTTCACGTTTCAAAAAGTAGTCTTCAAATTCATTCCCCTTAGTTGCT
                      ____________________________________________________________
consensus ATCCCCATGAGCAGTTCACGTTTCAAAAAGTAGTCTTCAAATTCATTCCCCTTAGTTGCT
 
. : . : . : . : . : . :
JMSF032M18+ GTCACGTCCTCAGTTCTGTACCGTGTATCTGGTGGAGGTATATTCAACTGCGCCTTCCAA
JMFF050E01+ GTCACGTCCTCAGTTCTGTACCGTGTATCTGGTGGAGGTATATTCAACTGCGCCTTCCAA
JMFF045N22+ GTCACGTCCTCAGTTCTGTACCGTGTATCTGGTGGAGGTATATTCAACTGCGCCTTCCAA
JMSF050C14+ GTCACGTCCTCAGTTCTGTACCGTGTATCTGGTGGAGGTATATTCAACTGCGCCTTCCAA
                      ____________________________________________________________
consensus GTCACGTCCTCAGTTCTGTACCGTGTATCTGGTGGAGGTATATTCAACTGCGCCTTCCAA
 
. : . : . : . : . : . :
JMSF032M18+ TTTTGCGAACTTGCATCAATTCCTTCAGATTGCACGGTCTTTTCAACCTCGTCGGCGGTA
JMFF050E01+ TTTTGCGAACTTGCATCAATTCCTTCAGATTGCACGGTCTTTTCAACCTCGTCGGCGGTA
JMFF045N22+ TTTTGCGAACTTGCATCAATTCCTTCAGATTGCACGGTCTTTTCAACCTCGTCGGCGGTA
JMSF050C14+ TTTTGCGAACTTGCATCAATTCCTTCAGATTGCACGGTCTTTTCAACCTCGTCGGCGGTA
JMSF017K01+ TGCGAACTTGCATCAATTCCTTCAGATTGCACGGTCTTTTCAACCTCGTCGGCGGTA
                      ____________________________________________________________
consensus TTTTGCGAACTTGCATCAATTCCTTCAGATTGCACGGTCTTTTCAACCTCGTCGGCGGTA
 
. : . : . : . : . : . :
JMSF032M18+ AAATCAGCACCCAACTCGTTGTTCCGTCTGAGCCACTGCTGGGTTTGCTGGTTCTGGAAA
JMFF050E01+ AAATCAGCACCCAACTCGTTGTTCCGTCTGAGCCACTGCTGGGTTTGCTGGTTCTGGAAA
JMFF045N22+ AAATCAGCACCCAACTCGTTGTTCCGTCTGAGCCACTGCTGGGTTTGCTGGTTCTGGAAA
JMSF050C14+ AAATCAGCACCCAACTCGTTGTTCCGTCTGAGCCACTGCTGGGTTTGCTGGTTCTGGAAA
JMSF017K01+ AAATCAGCACCCAACTCGTTGTTCCGTCTGAGCCACTGCTGGGTTTGCTGGTTCTGGAAA
                      ____________________________________________________________
consensus AAATCAGCACCCAACTCGTTGTTCCGTCTGAGCCACTGCTGGGTTTGCTGGTTCTGGAAA
 
. : . : . : . : . : . :
JMSF032M18+ TGCTGTTGATTTGGAAGTGGACTTCGCTGGACGTACTGATGAGGATTTCTAGGCTTAAAA
JMFF050E01+ TGCTGTTGATTTGGAAGTGGACTTCGCTGGACGTACTGATGAGGATTTCTAGGCTTAAAA
JMFF045N22+ TGCTGTTGATTTGGAAGTGGACTTCGCTGGACGTACTGATGAGGATTTCTAGGCTTAAAA
JMSF050C14+ TGCTGTTGATTTGGAAGTGGACTTCGCTGGACGTACTGATGAGGATTTCTAGGCTTAAAA
JMSF017K01+ TGCTGTTGATTTGGAAGTGGACTTCGCTGGACGTACTGATGAGGATTTCTAGGCTTAAAA
                      ____________________________________________________________
consensus TGCTGTTGATTTGGAAGTGGACTTCGCTGGACGTACTGATGAGGATTTCTAGGCTTAAAA
 
. : . : . : . : . : . :
JMSF032M18+ TCAGGGTTTGCGTTAGGGTTCAGGCCGGCACCTCCTCTTCCGCCGCTGCTCATCCCAGGC
JMFF050E01+ TCAGGGTTTGCGTTAGGGTTCAGGCCGGCACCTCCTCTTCCGCCGCTGCTCATCCCAGGC
JMFF045N22+ TCAGGGTTTGCGTTAGGGTTCAGGCCGGCACCTCCTCTTCCGCCGCTGCTCATCCCAGGC
JMSF050C14+ TCAGGGTTTGCGTTAGGGTTCAGGCCGGCACCTCCTCTTCCGCCGCTGCTCATCCCAGGC
JMSF017K01+ TCAGGGTTTGCGTTAGGGTTCAGGCCGGCACCTCCTCTTCCGCCGCTGCTCATCCCAGGC
                      ____________________________________________________________
consensus TCAGGGTTTGCGTTAGGGTTCAGGCCGGCACCTCCTCTTCCGCCGCTGCTCATCCCAGGC
 
. : . : . : . : . : . :
JMSF032M18+ GGCGGATATCTTGCTCTATAATTCATCTAACAAAATTTTCACACGAGCTAGCCGGAATCA
JMFF050E01+ GGCGGATATCTTGCTCTATAATTCATCTAACAAAATTTTCACACGAGCTAGCCGGAATCA
JMFF045N22+ GGCGGATATCTTGCTCTATAATTCATCTAACAAAATTTTCACACGAGCTAGCCGGAATCA
JMSF050C14+ GGCGGATATCTTGCTCTATAATTCATCTAACAAAATTTTCACACGAGCTAGCCGGAATCA
JMSF017K01+ GGCGGATATCTTGCTCTATAATTCATCTAACAAAATTTTCACACGAGCTAGCCGGAATCA
                      ____________________________________________________________
consensus GGCGGATATCTTGCTCTATAATTCATCTAACAAAATTTTCACACGAGCTAGCCGGAATCA
 
. : . : . : . : . : . :
JMSF032M18+ ATAACCCCTAAAATGAATCCCTAAAAACTTCCGCCGTGAATACAGAAGATATGTTCTATT
JMFF050E01+ ATAACCCCTAAAATGAATCCCTAAAAACTTCCGCCGTGAATACAGAAGATATGTTCTATT
JMFF045N22+ ATAACCCCTAAAATGAATCCCTAAAAACTTCCGCCGTGAATACAGAAGATATGTTCTATT
JMSF050C14+ ATAACCCCTAAAATGAATCCCTAAAAACTTCCGCCGTGAATACAGAAGATATGTTCTATT
JMSF017K01+ ATAACCCCTAAAATGAATCCCTAAAAACTTCCGCCGTGAATACAGAAGATATGTTCTATT
                      ____________________________________________________________
consensus ATAACCCCTAAAATGAATCCCTAAAAACTTCCGCCGTGAATACAGAAGATATGTTCTATT
 
. : . : . : . : . : . :
JMSF032M18+ TTGTTTTTCCTCAGCAAAGCAGCTCGACAAATACCGCGATGGAGACGATGGTC
JMFF050E01+ TTGTTTTTCCTCAGCAAAGCAGCTCGACAAATACCGCGATGGAGACGATGGTCA
JMFF045N22+ TTGTTTTTCCTCAGCAAAGCAGCTCGACAAATACCGCGATGGAGACGATGGTCA
JMSF050C14+ TTGTTTTTCCTCAGCAAAGCAGCTCGACAAATACCGCGATGGAGACGATGGTCA
JMSF017K01+ TTGTTTTTCCTCAGCAAAGCAGCTCGACAAATACCGCGATGGAGACGATGGTCAAGACCC
                      ____________________________________________________________
consensus TTGTTTTTCCTCAGCAAAGCAGCTCGACAAATACCGCGATGGAGACGATGGTCAAGACCC