Previous Contig 005690:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007G17Sequence637005690 (3)gb:AP004586_18419220.043Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P049726011966 (3)gb:ATF2I11_15504702e-12Arabidopsis thaliana DNA chromosome 5, BAC clone F2I11 (ESSA project).
JMSF017I04Sequence163005690 (3)737011966 (3)gb:ATF2I11_15504702e-12Arabidopsis thaliana DNA chromosome 5, BAC clone F2I11 (ESSA project).
JMSF018P18Sequence251005690 (3)727011966 (3)gb:ATF2I11_15504706e-15Arabidopsis thaliana DNA chromosome 5, BAC clone F2I11 (ESSA project).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF007G17+ CTGTTTCCTTGCATATGCGCTC
                      ____________________________________________________________
consensus CTGTTTCCTTGCATATGCGCTC
 
. : . : . : . : . : . :
JMFF007G17+ TCTGGCTTCACAATGTCTTTCAAGGAGGAACAAGAAGCCGCATCTGATAGACAGGTAGAT
                      ____________________________________________________________
consensus TCTGGCTTCACAATGTCTTTCAAGGAGGAACAAGAAGCCGCATCTGATAGACAGGTAGAT
 
. : . : . : . : . : . :
JMFF007G17+ GATTTGGATTTACATCTCCTCCAGTCCAGTCCAGTCCAGATTGACGCAAACACGAAAGCC
                      ____________________________________________________________
consensus GATTTGGATTTACATCTCCTCCAGTCCAGTCCAGTCCAGATTGACGCAAACACGAAAGCC
 
. : . : . : . : . : . :
JMFF007G17+ TACCTCAACTCTGAAGCCATCAAATTGATGTTGTACAGCTCCTCAAAATTAGCTGGTTCT
                      ____________________________________________________________
consensus TACCTCAACTCTGAAGCCATCAAATTGATGTTGTACAGCTCCTCAAAATTAGCTGGTTCT
 
. : . : . : . : . : . :
JMFF007G17+ TCTCCACCCGATCCACCTCCCTCCATTCTCAAGACTTGATATGAGTGGGAATGTGAAGAA
                      ____________________________________________________________
consensus TCTCCACCCGATCCACCTCCCTCCATTCTCAAGACTTGATATGAGTGGGAATGTGAAGAA
 
. : . : . : . : . : . :
JMFF007G17+ GTGATAGGAGTGCAGGCCAGGGGTGTGTTTCAGTGCAATATTCTGCTTCGGAGGAGACGG
                      ____________________________________________________________
consensus GTGATAGGAGTGCAGGCCAGGGGTGTGTTTCAGTGCAATATTCTGCTTCGGAGGAGACGG
 
. : . : . : . : . : . :
JMFF007G17+ ACTTTGCATTCTCAAATCTCAATACTTCAATTCGGAGATTGGTCCGAAATCTATCTATGT
                      ____________________________________________________________
consensus ACTTTGCATTCTCAAATCTCAATACTTCAATTCGGAGATTGGTCCGAAATCTATCTATGT
 
. : . : . : . : . : . :
JMFF007G17+ GGCACTGCCGTCTGCCAGGCCCAGATACGCATTTCGCAATCATTAAACCCGTGCACCAGG
                      ____________________________________________________________
consensus GGCACTGCCGTCTGCCAGGCCCAGATACGCATTTCGCAATCATTAAACCCGTGCACCAGG
 
. : . : . : . : . : . :
JMFF007G17+ GCGCAATGTGCGCCTCCCAAACCGATGTTGTTTTGTATTCTGTCTTTCTTGGCCGATCGA
JMSF018P18+ CTGTCTTTCTTGGCCGATCGA
                      ____________________________________________________________
consensus GCGCAATGTGCGCCTCCCAAACCGATGTTGTTTTGTATTCTGTCTTTCTTGGCCGATCGA
 
. : . : . : . : . : . :
JMFF007G17+ CCGCCGCTTTTTCCTTTTCTCTCGATCTGCATCATCGAACGGTGGCCGCAGTAGTGGCGA
JMSF018P18+ CCGCCGCTTTTTCCTTTTCTCTCGATCTGCATCATCGAACGGTGGCCGCAGTAGTGGCGA
JMSF017I04+ TCTCTCGATNTGCATCATCGAACGGTGGCCGCAGTAGNGGCGA
                      ____________________________________________________________
consensus CCGCCGCTTTTTCCTTTTCTCTCGATCTGCATCATCGAACGGTGGCCGCAGTAGTGGCGA
 
. : . : . : . : . : . :
JMFF007G17+ TCGGCGGTGGTCTGCGTCGATATGGCGGAGCAGGGCGAACATCTCTTCGAAACAGTTTGC
JMSF018P18+ TCGGCGGTGGTCTGCGTCGATATGGCGGAGCAGGGCGAACATCTCTTCGAAACAGTTTGC
JMSF017I04+ TCGGCGGNGGTCTGCGTCGATATGGCGGAGCAGGGCGAACATCTCTTCGAAACAGTTTGC
                      ____________________________________________________________
consensus TCGGCGGTGGTCTGCGTCGATATGGCGGAGCAGGGCGAACATCTCTTCGAAACAGTTTGC
 
. : . : . : . : . : . :
JMFF007G17+ ATTAATGGCCATTTT
JMSF018P18+ ATTAATGGCCATTTT
JMSF017I04+ ATTAATGGCCATTTTATTTAAGACTATAATAACGCCAGATCGCGTTATTATAAATTATCC
                      ____________________________________________________________
consensus ATTAATGGCCATTTTATTTAAGACTATAATAACGCCAGATCGCGTTATTATAAATTATCC